ID: 974364345

View in Genome Browser
Species Human (GRCh38)
Location 4:60926961-60926983
Sequence CAGCTGCTTCTGGGGCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974364345_974364349 -6 Left 974364345 4:60926961-60926983 CCTTTCTGCCCCAGAAGCAGCTG No data
Right 974364349 4:60926978-60927000 CAGCTGAAATTATTCAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974364345 Original CRISPR CAGCTGCTTCTGGGGCAGAA AGG (reversed) Intergenic
No off target data available for this crispr