ID: 974377307

View in Genome Browser
Species Human (GRCh38)
Location 4:61095244-61095266
Sequence TACGTTGCCCTCTGTGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974377303_974377307 -6 Left 974377303 4:61095227-61095249 CCCTGAAAGCGCAACCCTACGTT No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data
974377302_974377307 6 Left 974377302 4:61095215-61095237 CCATTGCTCTGGCCCTGAAAGCG No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data
974377304_974377307 -7 Left 974377304 4:61095228-61095250 CCTGAAAGCGCAACCCTACGTTG No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data
974377298_974377307 25 Left 974377298 4:61095196-61095218 CCACTTTATGCCTGCCTGACCAT No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data
974377300_974377307 15 Left 974377300 4:61095206-61095228 CCTGCCTGACCATTGCTCTGGCC No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data
974377301_974377307 11 Left 974377301 4:61095210-61095232 CCTGACCATTGCTCTGGCCCTGA No data
Right 974377307 4:61095244-61095266 TACGTTGCCCTCTGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974377307 Original CRISPR TACGTTGCCCTCTGTGTCCT TGG Intergenic
No off target data available for this crispr