ID: 974384461

View in Genome Browser
Species Human (GRCh38)
Location 4:61187047-61187069
Sequence CATGCTAAGCTGCTAACTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974384461_974384463 -10 Left 974384461 4:61187047-61187069 CCCTGAGTTAGCAGCTTAGCATG No data
Right 974384463 4:61187060-61187082 GCTTAGCATGCTGAGTCCCCTGG No data
974384461_974384470 29 Left 974384461 4:61187047-61187069 CCCTGAGTTAGCAGCTTAGCATG No data
Right 974384470 4:61187099-61187121 ACCACTTCAAAACTATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974384461 Original CRISPR CATGCTAAGCTGCTAACTCA GGG (reversed) Intergenic
No off target data available for this crispr