ID: 974385869

View in Genome Browser
Species Human (GRCh38)
Location 4:61201582-61201604
Sequence CAGAGAAAGCAGCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 1, 2: 10, 3: 110, 4: 972}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974385869_974385873 8 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385873 4:61201613-61201635 TTCTCGTTATTTGCCGCGTGTGG 0: 1
1: 0
2: 0
3: 2
4: 27
974385869_974385875 13 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385875 4:61201618-61201640 GTTATTTGCCGCGTGTGGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 33
974385869_974385877 15 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385877 4:61201620-61201642 TATTTGCCGCGTGTGGTTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 502
974385869_974385879 27 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385879 4:61201632-61201654 GTGGTTGGGGGTGTCTGCACAGG 0: 1
1: 0
2: 0
3: 20
4: 301
974385869_974385880 28 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385880 4:61201633-61201655 TGGTTGGGGGTGTCTGCACAGGG 0: 1
1: 0
2: 4
3: 49
4: 1757
974385869_974385874 12 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385874 4:61201617-61201639 CGTTATTTGCCGCGTGTGGTTGG 0: 1
1: 0
2: 1
3: 1
4: 26
974385869_974385876 14 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385876 4:61201619-61201641 TTATTTGCCGCGTGTGGTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 304
974385869_974385881 29 Left 974385869 4:61201582-61201604 CCACCCTCCTGCTGCTTTCTCTG 0: 1
1: 1
2: 10
3: 110
4: 972
Right 974385881 4:61201634-61201656 GGTTGGGGGTGTCTGCACAGGGG 0: 1
1: 0
2: 2
3: 29
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974385869 Original CRISPR CAGAGAAAGCAGCAGGAGGG TGG (reversed) Intronic
900149098 1:1170537-1170559 CGGAGAGAGGAGGAGGAGGGAGG - Intergenic
900341423 1:2191110-2191132 TAGAGAAAGCTTCTGGAGGGAGG - Intronic
900479493 1:2891223-2891245 AAGAGGAAGCCGCAGGAGGGAGG + Intergenic
900685510 1:3945454-3945476 CAGAGAGGGCAGCAGGTGGTGGG - Intergenic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
900974945 1:6011158-6011180 CTGAGGGAGCAGCAGGAGTGAGG + Intronic
901063078 1:6482439-6482461 CAGAGAAAGTGACAGGAGGGAGG + Intronic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901396042 1:8982341-8982363 CAGAAAAATCATAAGGAGGGGGG + Intergenic
901632147 1:10653204-10653226 CATAGAAACCAACAGGATGGGGG + Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
901807672 1:11748544-11748566 TAGACGAAGCAGCAGGAGAGCGG - Exonic
902038607 1:13475816-13475838 GAGAGTAAGAGGCAGGAGGGAGG + Exonic
902190193 1:14757288-14757310 AAGAGAAAGCAGGAGCAGGCAGG - Intronic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902290509 1:15431836-15431858 CAGAGAAAGCAGGTTGAGGAGGG + Intergenic
902819843 1:18937154-18937176 CAGAGCAATCTCCAGGAGGGAGG + Intronic
902899902 1:19507693-19507715 CACAGGAAGCTGCAGGTGGGCGG - Intergenic
903331733 1:22600127-22600149 GAGAGAAGGAAGGAGGAGGGAGG + Intronic
903450763 1:23452306-23452328 CAGAGAAAGCAGCTCGAGTATGG + Intronic
903641482 1:24863133-24863155 CAGAAGATGCAGGAGGAGGGTGG - Intergenic
903753118 1:25642174-25642196 CAGAGGCAGCCACAGGAGGGAGG - Intronic
903779360 1:25811490-25811512 CAGTGAAAGCAGCAACATGGAGG + Exonic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903999113 1:27328262-27328284 CAGAGAAAGCATGGGGTGGGAGG + Intronic
904016616 1:27426331-27426353 CAGAGAAAGAAGGTAGAGGGAGG + Intronic
904082621 1:27881861-27881883 AAAAGACAGCAGCGGGAGGGAGG + Intronic
904324437 1:29718881-29718903 CAGAGGAAGGAGCAAGAGAGAGG + Intergenic
904324565 1:29719943-29719965 AAGGGAAAGCAGCACGAGGGTGG - Intergenic
904329576 1:29749507-29749529 CAGAGAAAGCAGGGTGAGGGAGG + Intergenic
904696537 1:32334847-32334869 AAGAGAAATCGGAAGGAGGGTGG - Exonic
904715173 1:32462428-32462450 CAGAGAAAGCATCAGAAGTGAGG - Intergenic
904836107 1:33338006-33338028 CAGCGAAAGAGGCAGGAGGTGGG - Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905002541 1:34684419-34684441 CAGAGAAGGGAGCAGCTGGGGGG - Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905261118 1:36719861-36719883 CTGAGAATGCAGCAGTGGGGTGG + Intergenic
905654052 1:39674696-39674718 CAGAGAGAGAAGCAGAAGGAGGG + Intergenic
905734471 1:40316207-40316229 CAGAGAAAGGAGGTGTAGGGAGG + Intronic
905768916 1:40624956-40624978 GGGAGAAAGCAGCAGGACAGTGG - Exonic
905865265 1:41373041-41373063 AGGAGAAAGCAGCAGGGAGGAGG + Intronic
905890707 1:41516750-41516772 CAGAGGGAGCAGCAGGTGTGGGG - Intronic
905915859 1:41683874-41683896 CAGTGATAGGACCAGGAGGGTGG - Intronic
906687563 1:47772324-47772346 CAGAGAGAGGAGCAGGACGAAGG + Intronic
907206187 1:52773931-52773953 CAGAGAAACCAGGCCGAGGGTGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
907928667 1:58978835-58978857 AACAGAAAGCAGTAGGATGGGGG + Intergenic
908499961 1:64733333-64733355 CAGAGAAGGCAGCAGGACAAAGG - Intergenic
908724154 1:67157091-67157113 GAGAGAGAGCAGAAGCAGGGTGG - Intronic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909096361 1:71293173-71293195 GAGAGAAAGAAGAGGGAGGGAGG - Intergenic
909473808 1:76059516-76059538 CAGTGAAAGCAGCGGGTGGGAGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910240487 1:85080593-85080615 AAGAGAGAGCAGCAGGGGAGAGG + Intronic
910724527 1:90324538-90324560 CAGAGAACTCTGCAGGAAGGGGG + Intergenic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
910936641 1:92488350-92488372 CGCAGAAAGGAGCAGGTGGGAGG + Intergenic
911008756 1:93255780-93255802 AAGAGGAAGAAGAAGGAGGGGGG + Intronic
911292973 1:96080483-96080505 AGGAGAAAGAAGCAGGAAGGAGG + Intergenic
911380248 1:97105545-97105567 AATAGAAACCAACAGGAGGGAGG + Intronic
911406665 1:97449346-97449368 CAGAGAATTGAGGAGGAGGGAGG + Intronic
911687412 1:100793023-100793045 AAGAGAGAGAAGCAGGAGAGAGG + Intergenic
911829262 1:102530111-102530133 CAGGGAGGGCAGCAGGATGGAGG - Intergenic
912077778 1:105898270-105898292 TAGAGGAAGCTGGAGGAGGGAGG - Intergenic
912201646 1:107464752-107464774 CATAAAAAGGTGCAGGAGGGTGG - Intronic
912536822 1:110380066-110380088 AAAAAAAAGCAGCGGGAGGGAGG + Intronic
912700767 1:111876741-111876763 CAGAGAAGGCAAGAAGAGGGGGG + Intronic
912823820 1:112887711-112887733 CAGCCAAAGCAGCAGGAAGGCGG - Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
914912573 1:151799648-151799670 CAGAGGAAGCTGCAGAAGGATGG + Intergenic
914915635 1:151817540-151817562 CAGAGAAAGCAGCTGCAGAGGGG + Intronic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
915144716 1:153789667-153789689 CAGAGCGAGCTCCAGGAGGGCGG - Intergenic
915318123 1:155041193-155041215 CAGACAAGGCAGCTGGTGGGGGG + Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
915591640 1:156874322-156874344 GAGAGAAAGCAGTCAGAGGGAGG - Intronic
915591643 1:156874344-156874366 GAGAGAAAGCAGTCAGAGGGAGG - Intronic
915591646 1:156874366-156874388 AGGAGACTGCAGCAGGAGGGAGG - Exonic
915820880 1:159022464-159022486 AACCGAACGCAGCAGGAGGGTGG - Intronic
915932913 1:160070819-160070841 CAGAGAAAGCCGCTGCAGGTGGG - Intergenic
916584251 1:166136479-166136501 CAGAGACAGCAGCAGCTGTGAGG - Intronic
917140304 1:171828519-171828541 AAGAGAGAGAAGCAAGAGGGTGG + Intergenic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917564373 1:176196927-176196949 GAGTGAAACCAGCAGGAGGGAGG + Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918110452 1:181451043-181451065 CAGAGAAGGCAGCACAAGTGTGG + Intronic
918133243 1:181646936-181646958 CAGAGAAAGCAGTTCGGGGGCGG - Intronic
918241719 1:182626164-182626186 TAGAGGAATCAGCAGGAAGGTGG - Intergenic
918264249 1:182825828-182825850 CAGACAAAGCAGAAGATGGGTGG - Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918526934 1:185474918-185474940 CAGATTATGCTGCAGGAGGGAGG - Intergenic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919412632 1:197265287-197265309 GAAAGAAAGAAGCAGGAGAGAGG - Intergenic
919535548 1:198783125-198783147 GAGAGGAAGCAGCAGAAGGGGGG + Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919799569 1:201345347-201345369 AAGAGTCAGCTGCAGGAGGGAGG - Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920215337 1:204358727-204358749 GAGGGAGAGCTGCAGGAGGGTGG - Intronic
920528666 1:206685879-206685901 CAGAGAGAGAAAAAGGAGGGAGG - Intronic
920903499 1:210136288-210136310 GAGAGAGAGAAGCAGGAGGCAGG + Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
922698629 1:227744903-227744925 CAGGGATAGGGGCAGGAGGGAGG + Intronic
923033118 1:230265403-230265425 CAGAGAGAGCAGGAGTTGGGGGG + Intronic
924527256 1:244863673-244863695 CAGGGCCAGCAGCAGGCGGGAGG - Exonic
924687328 1:246307741-246307763 AAGAGAAAGCAGCACGAGGAGGG + Intronic
1062805311 10:415386-415408 GAGAGGCAGCAGGAGGAGGGAGG + Intronic
1063453760 10:6168949-6168971 AAGAGAAAGCATAAGGAGTGGGG - Intronic
1063460495 10:6212352-6212374 AAGACAAAACAGCAGGAAGGGGG - Intronic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063881699 10:10538362-10538384 CAGAGAGAGATGCAGAAGGGTGG + Intergenic
1063885743 10:10576690-10576712 CAGAGAAAGCACCCTGAAGGAGG - Intergenic
1063922275 10:10944944-10944966 CATAGAAGGCATCAGGAGAGGGG + Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1064971041 10:21067465-21067487 AAGAGAAAGCAGGAGGAGGGAGG + Intronic
1065456967 10:25916992-25917014 CAAATCTAGCAGCAGGAGGGAGG - Intergenic
1065984435 10:30935777-30935799 AAGAGAAAGCATGAGGAGTGAGG + Intronic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067664818 10:48268679-48268701 CAGAGATAGTAGAAGCAGGGTGG + Intronic
1067687758 10:48477808-48477830 CAGACAAGGCAGCAGAAGCGTGG - Intronic
1067961567 10:50857891-50857913 AAGAGAACCCAGCAGGAGGCTGG + Intronic
1068213561 10:53952964-53952986 TTGAGCATGCAGCAGGAGGGGGG + Intronic
1068252135 10:54456235-54456257 CTGTGAAAGCAGCTGAAGGGGGG + Intronic
1069077309 10:64051946-64051968 CCATGAAAGCAGCAGGAAGGGGG - Intergenic
1069800990 10:71081362-71081384 CAGTTAGAGCAGCAGGATGGAGG - Intergenic
1069889736 10:71645453-71645475 CAGAGGAAGGAGGAGGAGAGAGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070328815 10:75403999-75404021 CAGAGAAAGAAGCCGGGGAGGGG - Intergenic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1070651914 10:78243527-78243549 CTGAGAAAGCAGTGAGAGGGAGG + Intergenic
1070752745 10:78973756-78973778 GGGAGAAAGGAGCGGGAGGGCGG + Intergenic
1070784871 10:79157033-79157055 CAGAGAAGGCAGCATGGAGGAGG + Intronic
1070843663 10:79505283-79505305 AAGAGAAAGCTGAAGCAGGGAGG - Intergenic
1070930003 10:80254317-80254339 AAGAGAAAGCTGAAGCAGGGAGG + Intergenic
1071244747 10:83750612-83750634 CTCACAAAGCAGCAGGAGAGAGG - Intergenic
1071265056 10:83957644-83957666 CTGGGAAAGGAGCTGGAGGGAGG + Intergenic
1071384309 10:85104231-85104253 CAGAGGATGGAGCAGCAGGGAGG - Intergenic
1071409737 10:85377354-85377376 CAGAGAGAGAATAAGGAGGGAGG + Intergenic
1071730738 10:88245881-88245903 AAGAAAAAGCATCAGGATGGTGG - Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072415557 10:95243909-95243931 CATAGAGACAAGCAGGAGGGTGG + Intronic
1072722384 10:97789022-97789044 CCGAGAACTCTGCAGGAGGGTGG - Intergenic
1072861297 10:99007807-99007829 CTGAGAAAGCAGGAGCAGTGAGG + Intronic
1073140329 10:101242946-101242968 AAGAGAAAACAGCAGGAGCCAGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073302068 10:102476890-102476912 CAGAGAAACCACTAGAAGGGTGG - Exonic
1073568197 10:104553671-104553693 GAGAGAAAGCTGCCGGAGAGTGG + Intergenic
1073922073 10:108470709-108470731 CTATGAAAGCAGCAGTAGGGGGG - Intergenic
1074126196 10:110530506-110530528 CAGAGGATGCTCCAGGAGGGCGG + Intergenic
1074439551 10:113464132-113464154 CAGAGAACCCAAGAGGAGGGAGG + Intergenic
1074728284 10:116338213-116338235 CGGAGAAAGCGGCAGGAGTTTGG - Intronic
1074786995 10:116849924-116849946 CAGAGAAAGTGGCAGAAAGGAGG + Exonic
1074813860 10:117130507-117130529 GAGAAACAGCTGCAGGAGGGGGG - Intronic
1074841240 10:117353735-117353757 CAGACAAAGCAAGATGAGGGAGG + Intronic
1075007306 10:118840246-118840268 TAAAGGAAGCAGCAGGAAGGCGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075721753 10:124591447-124591469 CAGAGAAACCAGGAGTCGGGGGG - Intronic
1075918593 10:126190867-126190889 TAGAGCACGCAGCAGGTGGGAGG + Intronic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1077272221 11:1686732-1686754 CAGAGAAGGAGGGAGGAGGGAGG - Intergenic
1077495855 11:2886163-2886185 CAGACAAAGGAGCCGGCGGGGGG - Intergenic
1077931526 11:6737952-6737974 CAGAGAAACCTGCAGGACTGGGG + Intergenic
1078840658 11:15073540-15073562 CAGAGATAGCTGGAGGGGGGGGG - Exonic
1078966283 11:16348001-16348023 AAGAGAAAGAAGAGGGAGGGAGG + Intronic
1079077920 11:17395286-17395308 CACAGAAAGCCCCAGTAGGGAGG + Intronic
1079644142 11:22842792-22842814 AAAAGAAAGCAGCAGGGGAGGGG - Intergenic
1079883742 11:25959126-25959148 AAGATACAGCACCAGGAGGGTGG - Intergenic
1080120064 11:28666866-28666888 CAGTGAGCACAGCAGGAGGGAGG + Intergenic
1080643984 11:34174822-34174844 CAGAGAGAACAGCATGAGTGAGG - Intronic
1081162902 11:39772706-39772728 CTGAGAAACAAGCAGGAGTGGGG + Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081692268 11:45086576-45086598 CGGAGAGAGCAGGAGGAGGCCGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1082095219 11:48124460-48124482 AACAGAAAGAAGCAAGAGGGAGG - Intronic
1083174624 11:60941891-60941913 CAGGAAAAGCACCTGGAGGGTGG - Intronic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083665751 11:64273578-64273600 CAGAGTGAGAAGCAGGTGGGGGG + Intronic
1083883496 11:65559343-65559365 CACAGAACTCAGCAGGAGGTGGG + Intergenic
1084021018 11:66418356-66418378 AATAGCAAGCAGGAGGAGGGGGG - Intergenic
1084090235 11:66874943-66874965 CAGAGAAAGCTCCAGGAAGAAGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084686222 11:70697450-70697472 CACAGACAGAAGCAGGTGGGTGG + Intronic
1084793368 11:71489051-71489073 CAGAGAGAGCAGGAGGGGAGGGG + Intronic
1084911913 11:72396277-72396299 GAGAAAAGGCAGAAGGAGGGAGG + Intronic
1084943544 11:72626868-72626890 CAGAGGAGGCTGCAGGAGGTTGG - Intronic
1085263996 11:75225587-75225609 CAGAGAGAGCAGGAGGGGAGTGG - Intergenic
1085520025 11:77132242-77132264 CAGAGAAAGGAGGAGGACTGTGG - Intronic
1086000236 11:81974766-81974788 AAGAGAAAAGAGCAAGAGGGAGG - Intergenic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087125972 11:94626069-94626091 CTGTGCAAGCAACAGGAGGGGGG - Intergenic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087817917 11:102679383-102679405 GAGAGAGAGTAGGAGGAGGGTGG + Intergenic
1087831140 11:102820880-102820902 CAGAGAAGGCAGAGGGATGGGGG - Intergenic
1088089457 11:106021731-106021753 CAAAGGAGGCAGCGGGAGGGAGG - Exonic
1088598140 11:111455071-111455093 CAGAGGGAGCAGCAGCAGGTGGG + Exonic
1088834004 11:113561884-113561906 GAGAGAGAGAAGCAGGAGAGAGG + Intergenic
1089001306 11:115054539-115054561 CAGAAGAAGCAGCAGGAGAAAGG + Intergenic
1089563329 11:119356970-119356992 CACAGAAAGAAGCCGGCGGGGGG - Intronic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1090744310 11:129694228-129694250 CACAGAAAGCAGTGGGAGCGAGG - Intergenic
1091047116 11:132334603-132334625 CAGGCCAAGCAGCTGGAGGGTGG + Intronic
1091346424 11:134857215-134857237 GCCAGAAAGCAGGAGGAGGGAGG + Intergenic
1091411070 12:239657-239679 CAATGAAAGCCCCAGGAGGGTGG + Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092173858 12:6390028-6390050 GAGAGAAAGAAGAGGGAGGGAGG + Intronic
1092211201 12:6647426-6647448 CAGAGAGAGCCGCAGGCGCGGGG + Exonic
1092709752 12:11323280-11323302 AAGAGAAACCAGCAGGAGCAAGG + Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092743827 12:11654637-11654659 AAGAGGAAGTAGTAGGAGGGAGG + Intronic
1092746501 12:11677274-11677296 CAGAGAGAGAGGCAGGAGGAGGG - Intronic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1095253655 12:40008245-40008267 CATAAAAAGCAGCAGGGTGGTGG + Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1096264270 12:50111093-50111115 CAGATCAGGCAGCAGGAGTGAGG + Exonic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096837207 12:54358537-54358559 CAGAGAAAGGCGCAATAGGGAGG - Intergenic
1096868633 12:54579543-54579565 CAAAAACAGCAGCAGGAGAGAGG + Exonic
1097151123 12:56980729-56980751 CAGAGAAAGCATTAGGAGAAAGG - Intergenic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098460769 12:70730842-70730864 GAGAGAGAGCAGAAGGAAGGAGG + Intronic
1098467080 12:70799856-70799878 CAGAGAGAGCAGCAGCAGGTAGG + Intronic
1098519700 12:71421261-71421283 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1098840077 12:75467402-75467424 TAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1100348278 12:93753791-93753813 CAGTGAAAGCAGCTGGGAGGGGG - Intronic
1101180056 12:102206538-102206560 CAGAGAAAGCTGCAAAAGGAAGG - Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101758483 12:107639996-107640018 GAGAGAGAGCAGCAGAAGTGGGG + Intronic
1102524911 12:113505580-113505602 CCAAGAAGGCAGCAGGAGGCAGG + Intergenic
1102576642 12:113860096-113860118 CAGAGGAGGCACCAGGAGGGGGG - Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102795277 12:115683797-115683819 GAGAGCAAGCAGGGGGAGGGAGG + Intergenic
1102915233 12:116747603-116747625 CCGAAATGGCAGCAGGAGGGAGG - Intronic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1103943395 12:124513004-124513026 CCGAGAGAGCAGCGGGAGGTGGG - Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104243948 12:127018766-127018788 CAGAGAAAGTGGATGGAGGGAGG - Intergenic
1104276828 12:127336728-127336750 CAGGGAGAGCAACAGGAAGGTGG + Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1104815627 12:131644061-131644083 CAGAGAAGGCGGCAGGGAGGGGG - Intergenic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105429079 13:20320811-20320833 AAGGGAAAGCAGCATGAGTGTGG - Intergenic
1106928878 13:34641819-34641841 AAGAGAAAGCAGGCGCAGGGTGG + Intergenic
1107136564 13:36950926-36950948 CAGATAAAGTATCAGGAGGAAGG + Intronic
1107289913 13:38840250-38840272 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1107938441 13:45364280-45364302 TGGAGAAAGCAGGAGCAGGGAGG - Intergenic
1108269860 13:48748953-48748975 CAGAACAAGCAGCAGGTGTGAGG - Intergenic
1108701501 13:52948023-52948045 CAGAGACACCAGCAGGCGTGGGG + Intergenic
1108790737 13:53966600-53966622 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1109121270 13:58461075-58461097 CACAGAAAGCAACAAGAGAGTGG - Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1110929170 13:81194123-81194145 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
1111474267 13:88725220-88725242 CAGAGTAGGCACCAGGAGTGGGG - Intergenic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1112294780 13:98177086-98177108 CGGAGAGAGCAGCAGCAGCGGGG - Exonic
1113108421 13:106796348-106796370 CAGAGGAGGCGGCAGCAGGGAGG - Intergenic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1114080774 14:19200273-19200295 CAGAGGACACAGAAGGAGGGAGG + Intergenic
1114482426 14:23044098-23044120 CAGAGGGAGCATCAGGAAGGAGG - Exonic
1114635345 14:24184019-24184041 CAGTGACAGCAGCATGAGCGTGG + Exonic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1115085741 14:29512993-29513015 CTGTGAAAGCAGCTGGAGGGAGG - Intergenic
1115175706 14:30559309-30559331 CAGAGAGAGAAGCAGGACCGTGG + Intronic
1115929806 14:38478323-38478345 CCATGAAAGCAGCTGGAGGGAGG + Intergenic
1117192295 14:53304975-53304997 CACAGCCAGCAGCATGAGGGGGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117424666 14:55580965-55580987 CACGGAAAGCAGCATGAGGGGGG + Intronic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1117710620 14:58525405-58525427 GAGAGCAAGCAGAAGCAGGGTGG + Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118174157 14:63421300-63421322 CAGAGAAGGCAGCACAAGGAAGG + Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118789170 14:69073489-69073511 TAAAGAAAGCAGCAGGGGGCTGG + Intronic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1119893027 14:78197332-78197354 CAGAGAAGCAAGAAGGAGGGAGG - Intergenic
1120167973 14:81220678-81220700 CGGAGAGAGGAGGAGGAGGGGGG + Exonic
1120554981 14:85918632-85918654 AAGAGAAAGCGGAAGGATGGAGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121550100 14:94792841-94792863 AAGAGAAAGAGGAAGGAGGGAGG + Intergenic
1121728171 14:96167936-96167958 CAGAGAAAACAGCATGAGACAGG - Intergenic
1122173160 14:99893666-99893688 CAGAAAAAGCATCCGCAGGGAGG - Intronic
1122280702 14:100620635-100620657 CAGAGAATGCAGCAGAGTGGTGG + Intergenic
1122524442 14:102370780-102370802 CAGAGAGAGCTGCAGGTGAGAGG + Intronic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123578369 15:21695059-21695081 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123614994 15:22137541-22137563 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1123885888 15:24728086-24728108 TAAAGAAAGCAGCAGGAAGGTGG - Intergenic
1123983117 15:25621667-25621689 CAAAAAAACCAGCAGCAGGGCGG - Intergenic
1124129967 15:26974571-26974593 CAGAGACAGCAGAGGGAGGGAGG + Intronic
1124267259 15:28247932-28247954 CAGAGAAAGCCTCATGATGGAGG + Intronic
1124354493 15:28984810-28984832 CAGAGATGGCAGTGGGAGGGGGG - Intronic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1125431532 15:39599527-39599549 GAGAGAAAGAAGGAGGAGGGAGG - Intergenic
1125744549 15:41989556-41989578 CACATGAAGCAGCAGGACGGGGG + Intronic
1125892418 15:43276429-43276451 CAGGGAGGGCAGCTGGAGGGCGG + Exonic
1126064920 15:44819366-44819388 CAGAGACTGCAGCAAGAGGAGGG - Intergenic
1126094914 15:45081221-45081243 CAGAGACTGCAGCAAGAGGAGGG + Intergenic
1126114827 15:45199058-45199080 TGGAGGATGCAGCAGGAGGGAGG - Exonic
1126177091 15:45745815-45745837 CAGAGGAAACAGCAGGTGTGAGG + Intergenic
1126901012 15:53314238-53314260 CAGAGAAAGAAACAGGACTGTGG - Intergenic
1127629199 15:60810754-60810776 CAGAGAAAGCAGCAAGTTAGAGG - Intronic
1127782029 15:62325439-62325461 GAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1127818228 15:62631714-62631736 AAGAAAAAGCGGGAGGAGGGAGG - Intronic
1127968514 15:63941772-63941794 TACAGAAAGGAGCATGAGGGTGG + Intronic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130226000 15:82058839-82058861 TAGAGAAAGGAAGAGGAGGGAGG - Intergenic
1130330523 15:82918656-82918678 CAGGGAGAACAGCAGCAGGGAGG - Intronic
1130543502 15:84838957-84838979 CTGAGAAAGAAGCAGGAGACTGG - Intronic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1131278658 15:91003396-91003418 GGGAGGATGCAGCAGGAGGGAGG + Intronic
1131379253 15:91950170-91950192 CAGAGGAAGCAGCTGGAATGAGG + Intronic
1131842309 15:96450415-96450437 AAGAGAAGGCAGTAGGATGGGGG - Intergenic
1132050554 15:98604590-98604612 GAGAGAAGGCAGCAGAAGGAGGG + Intergenic
1132378523 15:101348905-101348927 GAGTGAGAGGAGCAGGAGGGTGG - Intronic
1202987239 15_KI270727v1_random:429304-429326 GAGGGAAATCAGCAGGAGGTAGG + Intergenic
1132739229 16:1403061-1403083 CAGAGCCTGCAGCAGCAGGGAGG + Intronic
1133103942 16:3494881-3494903 CAGAGGAGACAGCGGGAGGGTGG + Intronic
1133124026 16:3633215-3633237 CAGAGAAAGCAGAAAAAGAGTGG - Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133414681 16:5597235-5597257 CAGAGAAAGCGGGAGGGGGGTGG - Intergenic
1134005924 16:10818731-10818753 GAGAGAAAGCGGCGGCAGGGAGG + Exonic
1134507627 16:14821006-14821028 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134695325 16:16219768-16219790 CAGGCAAAGCAGCAGCTGGGAGG + Intronic
1134834401 16:17348718-17348740 AAAAGATAGCAGCACGAGGGAGG - Intronic
1134839448 16:17390069-17390091 CTCACAAAGCAGCAGGAGAGGGG + Intronic
1134976507 16:18574918-18574940 CAGGCAAAGCAGCAGCTGGGAGG - Intergenic
1135328147 16:21540774-21540796 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1135472569 16:22744490-22744512 CAGAGAAAGGAAGAGGATGGAGG + Intergenic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135859016 16:26038095-26038117 CAGAGGAAGCCACAGGAGAGTGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135994365 16:27237252-27237274 GAGAGCAGGCATCAGGAGGGAGG + Intronic
1136080987 16:27852530-27852552 CAGAGGGAGGAGGAGGAGGGTGG + Intronic
1136338500 16:29626794-29626816 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1136474881 16:30506678-30506700 CAGGGAAAGATGGAGGAGGGAGG - Intronic
1137333765 16:47527858-47527880 AGGACAAAGCAGCAGGAGGATGG + Intronic
1137465260 16:48702700-48702722 GAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137466426 16:48713971-48713993 CAGAGAAAGAAGGGGGAGGGAGG - Intergenic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137550865 16:49436698-49436720 GAGAGAAAGAAACAGGAGGCAGG - Intergenic
1138065195 16:53933556-53933578 CAGAGAAAGCCTCAGCTGGGTGG + Intronic
1138179205 16:54930931-54930953 AAGAGAAAGCAGCAAGGGAGGGG + Exonic
1138215915 16:55205174-55205196 GAGAGAAGTCAGCAGGAGGTTGG - Intergenic
1139244566 16:65428817-65428839 TTGAGAAAGCAGCTGCAGGGTGG - Intergenic
1139514709 16:67446276-67446298 CAGAGCAAGCAGGGGGAGTGGGG - Intronic
1139739775 16:69025315-69025337 CAGAGAAGGGAGCTGGAGAGAGG + Intronic
1140123387 16:72101808-72101830 CAGAGGAAGCAGTGTGAGGGAGG - Intronic
1140420839 16:74817518-74817540 CAGAGAAAGCAGCAGCAGCCAGG - Intergenic
1140949188 16:79799679-79799701 CAGAGAAAGAACCAAGAGGCTGG - Intergenic
1141137421 16:81475156-81475178 GAGAGAAAGAGACAGGAGGGAGG - Intronic
1141393322 16:83682644-83682666 CAGAGGAAGGAGGAGGAGTGAGG - Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141602758 16:85136509-85136531 CAGAGATGGCCGCAGGAAGGGGG - Intergenic
1141657207 16:85422611-85422633 GAGAGAAAGGGGCAGGAGAGAGG + Intergenic
1141767768 16:86070134-86070156 GAGAGGAAGCTGCATGAGGGCGG + Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142294523 16:89211627-89211649 CAGAGAGAGCTGCAGGGGAGGGG + Intergenic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143376868 17:6472172-6472194 CAGGGAGAACAGCAGGAGCGAGG - Intronic
1143413540 17:6728043-6728065 TCCAGAAGGCAGCAGGAGGGAGG - Intergenic
1143417029 17:6757834-6757856 CATGGGAAGGAGCAGGAGGGAGG - Intronic
1143434008 17:6909234-6909256 CAGAGAAAGCTGCATGGGGGAGG + Intronic
1143478913 17:7217629-7217651 GAGAGGAAGCAGGGGGAGGGAGG + Intronic
1143972240 17:10804030-10804052 CAGAGAAGGCAGCAGCAGGCAGG - Intergenic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144453742 17:15402510-15402532 CAGAGGAGGCAGCAAGAGGCCGG + Intergenic
1144634249 17:16893972-16893994 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1144783341 17:17818662-17818684 CAGAGAAAGCAGGAAGAGGATGG - Intronic
1144794915 17:17884546-17884568 CAAAGGCAGCAGCAGAAGGGTGG + Intronic
1144819969 17:18065643-18065665 CAGACAAAGCAACTGGCGGGGGG - Exonic
1145168363 17:20633867-20633889 CAGCGCCAGCAGCAGGAGGGCGG - Intergenic
1145276999 17:21437511-21437533 CAGAGGCAGCAGCAGGAGCAGGG - Intergenic
1145314829 17:21723404-21723426 CAGAGGCGGCAGCAGGAGTGGGG - Intergenic
1145713270 17:26995341-26995363 CAGAGGCGGCAGCAGGAGCGGGG - Intergenic
1146132191 17:30287880-30287902 CAGAGAAAGGAGCCTGAGGATGG - Exonic
1146139966 17:30357266-30357288 CTGAGAAGGCAGCAGGGGGATGG + Intergenic
1146178098 17:30679574-30679596 CAGAGAAGGCAGGAGGACAGAGG + Intergenic
1146491754 17:33288320-33288342 CAGACAAAGCAGCATGAAAGGGG + Intronic
1146821499 17:35986508-35986530 CAGGGAAATAAGCAGGAGTGAGG - Intronic
1147133637 17:38422935-38422957 CAGAGAAAGGAGGGAGAGGGTGG - Intergenic
1147254320 17:39173150-39173172 AAGAAAAAGAACCAGGAGGGAGG + Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1148051020 17:44769953-44769975 CAGAGGGGGCAGCAGGAAGGGGG - Intronic
1148108670 17:45132540-45132562 CGGAGGAGGCAGCAGGAGGTGGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148746130 17:49919577-49919599 CAGAGGAAGCAGGTGGAGCGTGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149088640 17:52751285-52751307 CAGAGATTGCAGTGGGAGGGAGG - Intergenic
1150008041 17:61481708-61481730 TGGAGAAAACAGGAGGAGGGAGG + Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150164065 17:62924669-62924691 CAGAGAAAGCACCAGAAGCTAGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150608463 17:66714216-66714238 CAAAGGAAGCAGCGGGTGGGGGG - Intronic
1150647031 17:66985143-66985165 CAGATAAGGCAGGATGAGGGCGG - Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151752259 17:76046278-76046300 CAGAGGAAGCAGGGGGCGGGTGG + Intronic
1151768235 17:76143101-76143123 AAGAGAAGGCAGGGGGAGGGAGG + Exonic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152106889 17:78335437-78335459 CAGAGAAGAGGGCAGGAGGGAGG - Intergenic
1152698361 17:81807170-81807192 CGGAGACAGCGGCAGGCGGGTGG - Intronic
1152840773 17:82566719-82566741 AAAAGAAAGCAGCAGGTGGGAGG - Intronic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1203168922 17_GL000205v2_random:128709-128731 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1153628266 18:7042501-7042523 GAGAGACAGCAGCGCGAGGGGGG - Intronic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153834134 18:8949253-8949275 CCGAGAAGGCAGCAGGGGTGGGG + Intergenic
1154191364 18:12233553-12233575 CAGAGAAAATAGCAGGCGTGTGG - Intergenic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1154406174 18:14093288-14093310 AGGAGAAAGCGGCAGGATGGAGG - Intronic
1155384213 18:25259575-25259597 CAAAAACAGCAACAGGAGGGTGG + Intronic
1155384689 18:25264835-25264857 CAGAAAAAGCTTCAGGAAGGAGG + Intronic
1155406547 18:25494638-25494660 CTGATAAAGCAGCAGGTGGTAGG + Intergenic
1155839080 18:30625557-30625579 CAGAGAGAGGAGCTGGAGAGGGG + Intergenic
1155845415 18:30699514-30699536 CAGAGAATGCTGGAAGAGGGGGG + Intergenic
1155898837 18:31362716-31362738 GAAGGAAAGCAGCAGGAGGTAGG + Intergenic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1156856371 18:41786217-41786239 GAGAGGAGGCAGCAGGAGGAGGG + Intergenic
1156985172 18:43342259-43342281 CAGAGAAAGGATCAGGAATGGGG - Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157301934 18:46485399-46485421 CTGGGAATGCAGCAGGAGGTGGG + Intronic
1157342870 18:46794901-46794923 CAAACCAAGCAGCAGGATGGAGG - Intergenic
1157473336 18:48006571-48006593 TGGAGAAAGCACCAGCAGGGTGG - Intergenic
1157779813 18:50428237-50428259 CAGAGCAAGCAAAGGGAGGGAGG + Intergenic
1157797995 18:50593369-50593391 CAGAGGAAGCACCTGGAGGATGG - Intronic
1157941160 18:51930322-51930344 CTGTGAAAGCAGCTGGTGGGGGG + Intergenic
1158570730 18:58595213-58595235 AAGATAAAGCAGCACGAGGGAGG - Intronic
1159868868 18:73738022-73738044 GAGAGCAAGCAGCAGGACTGGGG - Intergenic
1160015132 18:75134274-75134296 CGGAGAAAGCTGCGGGAGGTGGG + Intergenic
1160150066 18:76391885-76391907 CAGAGCCAGCAGGAGGAGGCCGG + Intronic
1160191125 18:76714668-76714690 CAGAGACAGACTCAGGAGGGTGG - Intergenic
1160455545 18:78996460-78996482 GAGAGAAAGCAAGAGGAGAGGGG + Intronic
1160539603 18:79613368-79613390 CAAACAAAGCAGCAGCATGGAGG + Intergenic
1160676267 19:392975-392997 CTGAGAAATCAACAGGATGGGGG - Intergenic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1161058310 19:2201413-2201435 CAGGGAAGACAGCAGGAGCGAGG - Intronic
1161561683 19:4976678-4976700 CACAGAAAGCCTCATGAGGGAGG + Intronic
1161668477 19:5590911-5590933 CTGAGAAAGCAGCAGCCTGGTGG - Intronic
1162099556 19:8331628-8331650 CAGGGCAAGCAGCTGGAGGTGGG + Intronic
1162432057 19:10635059-10635081 CAAAGAAGCCAGCAGGTGGGGGG + Exonic
1163326302 19:16605575-16605597 CAGAGAGAGCAGCAGGAAAGGGG + Intronic
1164463534 19:28468635-28468657 CAAAGAAAGAAGCAGGAATGAGG + Intergenic
1164787009 19:30941510-30941532 CAGAGAAATCACTAGGAGGGAGG - Intergenic
1164982456 19:32624555-32624577 GAGAGAAGCCAGAAGGAGGGCGG + Intronic
1164995441 19:32717836-32717858 TAGAGAAAGCAGGAGGACAGGGG + Intergenic
1165490905 19:36122074-36122096 CAGAGGAAGCACCTGGAGGCTGG + Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1166329506 19:42069975-42069997 AAGAGAAAGGCGGAGGAGGGTGG + Intronic
1166416661 19:42600209-42600231 TAAAGGAAGCAGCTGGAGGGAGG - Intronic
1166433126 19:42742852-42742874 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166436227 19:42768079-42768101 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166446101 19:42858106-42858128 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166453484 19:42920257-42920279 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166455974 19:42939568-42939590 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166465765 19:43028837-43028859 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166471903 19:43085046-43085068 TAAAGAAAGCAGCTGGAGAGAGG - Intronic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166866875 19:45843992-45844014 AAGAGAAGGCAGGGGGAGGGGGG + Intronic
1167036793 19:46999602-46999624 CTCAGACAGGAGCAGGAGGGAGG - Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167403534 19:49288893-49288915 CCGTGAAAGCAGCTGGAAGGGGG + Intergenic
1167406798 19:49315332-49315354 CAGAGAATGCAACAGCAGGTGGG + Intronic
1167501174 19:49849463-49849485 CAGAGAAGGCAGCAAGAGTTAGG + Intergenic
1167554042 19:50181816-50181838 CAGAGAAAGACCCTGGAGGGTGG - Intergenic
1167608171 19:50492805-50492827 AAGAGGAAGGAGGAGGAGGGAGG + Intergenic
1167839848 19:52106778-52106800 AAGAGAAAATAGCAGGAGGAAGG - Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925841809 2:7999198-7999220 TAGAGAAAGTATCAAGAGGGAGG - Intergenic
926121306 2:10242646-10242668 CAGAGGAAGCTCCTGGAGGGAGG - Intergenic
926349430 2:11981928-11981950 AAGAGAAGGAAGCAGGTGGGAGG + Intergenic
926705271 2:15833143-15833165 GAGAGAAAGTTGGAGGAGGGTGG + Intergenic
926971744 2:18473602-18473624 CTGAGACAGCAGCAGCATGGAGG - Intergenic
927031776 2:19127759-19127781 CAGAGAAAGAGGCAGGTGTGAGG + Intergenic
927144919 2:20157272-20157294 CTTTGAAAGGAGCAGGAGGGAGG + Intergenic
927889317 2:26738543-26738565 CAGAGGGAGCAGCAGGTTGGTGG + Intergenic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
929072206 2:38043575-38043597 CAGAGAAGGCAGAAGAAGAGGGG - Intronic
929465863 2:42143202-42143224 CAGAAAAAGCAGCAGCAATGAGG - Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
930728933 2:54709359-54709381 CAGAGTGAGCAGCAGGAGCTGGG - Intergenic
930844373 2:55885891-55885913 GAGAGAAAGCAGCATGAGTCAGG - Intronic
930882643 2:56289507-56289529 CAGAGGGAGCAGCATGAGAGAGG + Intronic
930912090 2:56641271-56641293 CAGACAAAGCAGCACCATGGTGG - Intergenic
931231158 2:60375989-60376011 AAGGGAAAGCAGGAGGAGGCAGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932764319 2:74460469-74460491 CGGCGATAGCGGCAGGAGGGGGG - Exonic
933174406 2:79159337-79159359 CTGAGACAGCAGCATGAGGCAGG + Exonic
933894588 2:86799307-86799329 CATAGTAAGGAACAGGAGGGCGG - Intronic
933909837 2:86930121-86930143 CGGCGATAGCGGCAGGAGGGGGG + Intronic
933919487 2:87030320-87030342 CAGGTAAATCAGCACGAGGGAGG + Intergenic
933966663 2:87435533-87435555 GAGAGTGAGCAGCATGAGGGTGG - Intergenic
934003507 2:87739587-87739609 CAGGTAAATCAGCACGAGGGAGG - Intergenic
934022890 2:87973267-87973289 CGGCGATAGCGGCAGGAGGGGGG - Intergenic
934535342 2:95128707-95128729 AGGAGAAAGAAGGAGGAGGGAGG + Intronic
934729785 2:96649345-96649367 CAGAAAAGGATGCAGGAGGGTGG - Intergenic
934927425 2:98391344-98391366 CTGAGCAAGCAGCAGGTGGGCGG + Intronic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935654330 2:105409009-105409031 GCAAGAAAGCAGCAGGAGGTGGG + Intronic
935959969 2:108415208-108415230 CAGAGAAGGCACCAGTAGAGTGG - Intergenic
936539462 2:113338301-113338323 CAGACACAGCAGCAGGACTGGGG - Intergenic
936811490 2:116407974-116407996 GCATGAAAGCAGCAGGAGGGAGG + Intergenic
936989381 2:118346361-118346383 CAGCAAATGCACCAGGAGGGAGG + Intergenic
937900092 2:127013382-127013404 CAGAGACAGCAGCAGAGAGGTGG + Intergenic
938195173 2:129320559-129320581 AAGAGAAAGCAGCCAGATGGGGG - Intergenic
939171422 2:138700736-138700758 CCAAGAAACAAGCAGGAGGGAGG - Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
940814933 2:158287684-158287706 CCGTGAAAGCAGCCGGAAGGAGG - Intronic
941285885 2:163611396-163611418 CAGAGACATCTGCTGGAGGGAGG + Exonic
941933496 2:170965337-170965359 CTGCGAAGGCAGCAGAAGGGAGG - Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942211752 2:173678231-173678253 GAGAGAAAGAAGCAAGAGGGAGG + Intergenic
942342979 2:174969201-174969223 GAGAGAACGCAGCAGAAGAGTGG - Intronic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
943551624 2:189347357-189347379 AACAGAAAGCAGAAAGAGGGAGG + Intergenic
944128156 2:196317579-196317601 CAGGGGAAGCTGCAGGAGCGGGG - Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
944856746 2:203775490-203775512 CAGAGCAAGCTGGAGGATGGGGG - Intergenic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945266127 2:207893098-207893120 CAGAGAAAGCAGCAGCCAGTTGG + Intronic
945324996 2:208471830-208471852 TTGTGAAAGAAGCAGGAGGGGGG + Intronic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946254892 2:218435221-218435243 CAGTGAATGTAGTAGGAGGGTGG + Intronic
946385846 2:219384075-219384097 CAGGAAAAGCAGCAGGAGCAAGG + Intronic
946683184 2:222239339-222239361 CAGAGAGAGAAGGAGGGGGGAGG + Intronic
946764735 2:223030085-223030107 CAGAGAAAGCAGGAGGTAGGGGG + Intergenic
947065159 2:226216514-226216536 TAGAGAGAGCACCAGGAGTGAGG - Intergenic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947530868 2:230907938-230907960 CAGAGAAAGAAGTGGGAGGAGGG + Exonic
947531947 2:230914890-230914912 GAGAGAGAGCAGGAGGAGGTGGG + Intronic
947729660 2:232420923-232420945 CAGAGAAGGCAGCGGGAGCGGGG - Intergenic
947948220 2:234124765-234124787 CAGGGACAGCAGCAAGAGGCTGG - Intergenic
947982017 2:234418631-234418653 CAGAGATAACAGCAGGTGTGTGG - Intergenic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
948570869 2:238916429-238916451 GAGGGAAAGAAGGAGGAGGGAGG + Intergenic
948570880 2:238916475-238916497 GAAAGAAAGAAGGAGGAGGGAGG + Intergenic
1168829322 20:835923-835945 GAAAGAAAGAAGCAGGTGGGAGG + Intronic
1169277212 20:4241862-4241884 GAGAGAAGGCAGGAGGAGGCAGG - Intronic
1169379730 20:5096110-5096132 CAGAGCCAGCGGCAGGAGCGAGG - Intronic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169477090 20:5941297-5941319 CAAAGACAGCAGCAGGGGAGTGG + Exonic
1170152126 20:13236892-13236914 CCCTGAAAGCAGCTGGAGGGAGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170878418 20:20272670-20272692 GAGAGAAAGCAGCTGCTGGGCGG - Intronic
1170933037 20:20786037-20786059 GAGAGAGAGAAGAAGGAGGGGGG - Intergenic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171287572 20:23954373-23954395 CAGAGCATGCAGGAGGAGAGTGG - Intergenic
1171327733 20:24310544-24310566 CAGAGGAAGCAGCAGGAGTGTGG + Intergenic
1171392718 20:24811757-24811779 CACAGGCAGCATCAGGAGGGTGG - Intergenic
1171435370 20:25118043-25118065 CAGGGAAAGCAGGATGAGGCTGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172124324 20:32616353-32616375 GAGAGAAAGCATCAAGGGGGAGG + Intergenic
1172180607 20:33001184-33001206 CAGGGAAGGCAGGGGGAGGGTGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172569790 20:35960932-35960954 AAGAAAAAGCGGGAGGAGGGGGG - Intronic
1172637071 20:36417124-36417146 GAGAGAACGCAGTGGGAGGGAGG + Intronic
1172757922 20:37300225-37300247 CAGAGAAGTGATCAGGAGGGAGG - Intronic
1172778607 20:37422768-37422790 CAGAGGAGGAAGGAGGAGGGAGG - Intergenic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172925049 20:38526353-38526375 AAGAGAAAGAGGCAGGAGGAAGG - Intronic
1173050462 20:39554845-39554867 CAGAGACAGAAGCAGGTCGGTGG + Intergenic
1173384499 20:42575165-42575187 CATAGAAAGACGCAGGAAGGTGG + Intronic
1173590760 20:44222800-44222822 CAGAGAGGGAAGCAAGAGGGAGG - Intergenic
1173999287 20:47362604-47362626 CAGAGTGAGCCACAGGAGGGTGG - Intergenic
1174055791 20:47797295-47797317 CACATAGAGCAGCAGGAAGGGGG - Intergenic
1174187530 20:48717223-48717245 AAGAGAAAAAGGCAGGAGGGTGG + Intronic
1174556043 20:51396466-51396488 CTGAGAAAGCAGCAACAGGAAGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1175117316 20:56691652-56691674 CACCGAGAGAAGCAGGAGGGAGG + Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175642515 20:60642877-60642899 CAGGGAAAGAAGCAGGCAGGAGG - Intergenic
1175659664 20:60801829-60801851 CAGAAAAGGCAGCAGGAATGAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175874596 20:62223404-62223426 CAGAGGCAGCAGCAGCAGGTGGG - Intergenic
1176243307 20:64084911-64084933 CAGAGAAGGCAGCAAGCAGGGGG - Intronic
1176402832 21:6330445-6330467 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1176434325 21:6658659-6658681 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1176458587 21:6985729-6985751 CAGAGACTGAAGCAGGAGGATGG + Intergenic
1178255459 21:31048200-31048222 CAGTGAAAGCAGGAGAAGGCTGG + Intergenic
1178327339 21:31656645-31656667 AAGAGAAAGAAGAAGGAAGGAGG - Intergenic
1178505544 21:33159817-33159839 CATTGCAAGCAGCAGGTGGGAGG + Intergenic
1178633002 21:34278871-34278893 CAGAGAAGCTTGCAGGAGGGTGG - Intergenic
1178705375 21:34868534-34868556 CAGAGAAAGCAGAGTGAGGAAGG - Intronic
1178886754 21:36490776-36490798 CAGAGAAAGGCCCAGGTGGGAGG - Intronic
1178943309 21:36925566-36925588 CAGAGGAAGCAGAAGAAGGTGGG - Intronic
1179033614 21:37741479-37741501 CAGACAGAGCTGCAGGAGAGAGG - Intronic
1179768209 21:43590843-43590865 CAGGGAGAGGAGCAGGAAGGAGG + Intronic
1179822702 21:43945941-43945963 AGGAGAAGCCAGCAGGAGGGTGG + Intronic
1179875106 21:44263105-44263127 CAGGGAAGGGAGCAGGAAGGTGG + Intergenic
1179916177 21:44479678-44479700 CCGGGAAAGCGGCAGGGGGGCGG - Intergenic
1179973155 21:44847474-44847496 CTGAGAAGGCAGCAGGAGGGTGG - Intergenic
1180499999 22:15922412-15922434 CAGAGGACACAGAAGGAGGGAGG - Intergenic
1181343618 22:22201448-22201470 CAGAGAAAGCAGCAGCTGCTGGG - Intergenic
1181452886 22:23035755-23035777 AACAGAAAGCAGCAGGAGAGAGG + Intergenic
1181817198 22:25447517-25447539 GAGAAAAAGCAGCAGTAGTGTGG - Intergenic
1182083183 22:27543518-27543540 CAGAGAAACAGGGAGGAGGGAGG - Intergenic
1182204262 22:28607881-28607903 GAGTGAAAGCAGAAGCAGGGAGG - Intronic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1183198843 22:36372115-36372137 TAGAGAAAGCAACAGGAAGTGGG - Intronic
1184291800 22:43501371-43501393 GAGAGAAAGAAGGAAGAGGGAGG - Intronic
1184320674 22:43740009-43740031 GCCAGAAAGCAGCAGGTGGGGGG - Intronic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184571715 22:45328961-45328983 CAGAGAGAGTGGCAGGGGGGTGG + Intronic
1184799087 22:46749170-46749192 CAGAGAAAGCAGCAGGCAGTCGG - Intergenic
1185142994 22:49113616-49113638 TACACACAGCAGCAGGAGGGTGG - Intergenic
1185342247 22:50296865-50296887 CAGTGACACCAGCAGGGGGGCGG + Intronic
949239956 3:1859231-1859253 TAGAGAAACCAGCAAGAGGCTGG - Intergenic
950028903 3:9838999-9839021 CTCAGAAAGCAGCAGGCAGGTGG + Intronic
950115589 3:10448684-10448706 CAGACAAAGCAGTAGGAAGATGG - Intronic
951719201 3:25679801-25679823 GAGAGAGAGCAGCAGGACAGGGG + Intergenic
952539035 3:34346664-34346686 CAGAGAAAGACTCATGAGGGTGG - Intergenic
952655073 3:35776420-35776442 CAGGGAAAGCAGAGGAAGGGTGG + Intronic
952852581 3:37741202-37741224 CAGAGAAAGCCTCAGCAGGGTGG - Intronic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953178496 3:40574254-40574276 CAGAGAATGAGGGAGGAGGGAGG + Intronic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
953735644 3:45491871-45491893 CAGAGTTAGCACCAGGAGGGAGG - Intronic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954218901 3:49140327-49140349 CAGAGAAAGCAGGAAGGGAGAGG - Intergenic
954304417 3:49717900-49717922 CAGGGCGAGCAGCAAGAGGGTGG + Exonic
954456249 3:50601280-50601302 CAGAGGAGGCCGCAGGCGGGAGG - Intergenic
954524862 3:51261260-51261282 GAGGGCAAGCAGAAGGAGGGTGG + Intronic
954805397 3:53216960-53216982 CAGAGGAAGCACCAGGTGGGAGG - Intergenic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
954924498 3:54220609-54220631 CAGAGGAAGCAGCAGGTGTGGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955887234 3:63613474-63613496 GAGAGAAGGAAGAAGGAGGGAGG + Intronic
956371775 3:68571020-68571042 CAGGTAAAGCAGCATGAGGGAGG - Intergenic
956471060 3:69567245-69567267 CAGAGGAAGCAGCATAAGGAAGG - Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
957374358 3:79336793-79336815 CTGTGAAAGCAGCTGGAAGGGGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
957959167 3:87227393-87227415 GAGAGACAGCAGGAGGAGGTCGG - Exonic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
961093840 3:124138145-124138167 AAGAGAAAGCTGCAGGAGGGTGG - Intronic
961366221 3:126401672-126401694 GAGAGGGAGCAGCAGGTGGGAGG + Intronic
961598920 3:128043512-128043534 CAGAGAAGGGAGCTGGAGAGGGG + Intergenic
962204603 3:133424531-133424553 CAGATAAAGCAGCTGGAGGTGGG - Intronic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962684459 3:137833623-137833645 GAGAGAAAGAAGCATGTGGGAGG - Intergenic
962694086 3:137930498-137930520 GAGAGAAAGAAAGAGGAGGGAGG + Intergenic
963272683 3:143301379-143301401 CAGAGAAATCAGCAAGAGGGCGG + Intronic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963804896 3:149713739-149713761 CAGTGATAGCAGCAGCAGAGGGG + Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964419954 3:156491295-156491317 CAGAGACTGCAGCAGGACGATGG + Intronic
965622031 3:170651444-170651466 GAGAGCAAGCAGAAGCAGGGCGG - Intronic
965886900 3:173457116-173457138 CAGAGAAAGACACAGAAGGGTGG + Intronic
966016855 3:175150709-175150731 CAGAGTGAGCAGCAGAAGGGAGG - Intronic
966616285 3:181916714-181916736 CAGAGTTAGGAGCAGGATGGAGG - Intergenic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
968003623 3:195224669-195224691 GAGGGAAAGAGGCAGGAGGGAGG + Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968223972 3:196961025-196961047 CAGTCAAAGCAGCAGGAAGATGG - Intronic
968614907 4:1573392-1573414 GAGAGAAACCAGGAAGAGGGAGG - Intergenic
969042207 4:4307904-4307926 CAGAGAAAGCATGAGAAGGATGG - Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
969436569 4:7192525-7192547 CAGAGAAAGGAGCCGGCGAGGGG - Exonic
969537855 4:7767699-7767721 CAGAGAGCACAGCAGGGGGGCGG + Intronic
969873655 4:10120225-10120247 CAGAGAAATCAGCAGGGAAGGGG - Intergenic
970137100 4:12936996-12937018 CACAGACAGCAATAGGAGGGAGG - Intergenic
970158796 4:13168621-13168643 CAGAGAAAGTTGTAGGAAGGAGG - Intergenic
970187050 4:13467697-13467719 CAGAGAAAGCAGAAAAAGAGGGG + Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
971369536 4:26005393-26005415 TAGGGAAAGCAGCTGGAAGGTGG - Intergenic
972156784 4:36172892-36172914 CACAGAAAGGAGCAGCAGGATGG - Intronic
972582603 4:40407806-40407828 CAGTCAGAGAAGCAGGAGGGTGG - Intergenic
972766217 4:42153731-42153753 CTGAGGAAGCTGCAGGAGAGAGG - Intergenic
973699633 4:53523851-53523873 CAGGGGAAGCAGGAGGATGGTGG - Intronic
974037288 4:56827985-56828007 CTGTGAAAGCAGTGGGAGGGAGG + Intergenic
974255613 4:59450635-59450657 CAGAGAAAGTAGCAAGACTGAGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974421642 4:61683811-61683833 AAGTGAGAGCAGCAGGAGGCAGG - Intronic
974460089 4:62176118-62176140 AACTGAAAGCAGCAGGAGTGGGG + Intergenic
975193133 4:71489936-71489958 CAGGGAAAAGAGCAGGAGAGAGG + Intronic
975213047 4:71722968-71722990 GAGAGAGAGCAGAAGCAGGGTGG - Intergenic
975382106 4:73712548-73712570 CAGAGAAACCAGCAACAGGGTGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
976472713 4:85448049-85448071 CAGACAGTGCAGCTGGAGGGTGG + Intergenic
976499471 4:85770876-85770898 CAGAGAACGTTGCAGGAGTGGGG + Intronic
976883367 4:89957719-89957741 GAGAGAGAGGAGCATGAGGGCGG + Intergenic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
978610560 4:110534156-110534178 CAAAGAAACCAAGAGGAGGGAGG - Intronic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
979421310 4:120508953-120508975 GAGGGAAAGCAGAAGCAGGGTGG + Intergenic
979518460 4:121638745-121638767 CTGGGCAAGCAGCAGGAGGCTGG - Intergenic
979621540 4:122804070-122804092 GAGAGCAGGCAGCAGAAGGGTGG + Intergenic
979645216 4:123060149-123060171 CTGTGAAAGCAGCCAGAGGGAGG - Intronic
979699970 4:123656443-123656465 CTGTGAAAGCAGCTGGAAGGAGG - Intergenic
979721514 4:123905502-123905524 CTGTGAAAGCAGCTGGGGGGGGG + Intergenic
979928242 4:126595096-126595118 CAGAAGAAGCCACAGGAGGGAGG - Intergenic
980034748 4:127871030-127871052 TAGGGAAAACAGCAGGAGTGAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980707572 4:136519785-136519807 CAGTGAAAGCAGCTGGGAGGGGG - Intergenic
980855154 4:138431285-138431307 GACAGCAAGCAGCAGCAGGGTGG + Intergenic
980894953 4:138853224-138853246 GAAGGAAAGAAGCAGGAGGGAGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981588058 4:146325958-146325980 CACAAAAAGCAGCAGGAGCAGGG + Exonic
981602063 4:146501034-146501056 CAGAGAAAGCAGCAATAATGAGG - Intronic
982097891 4:151939849-151939871 CAGAGTCAGCAGCAGCAGAGTGG - Intergenic
983523679 4:168737922-168737944 CAGAGACAGCAGCAGCTGTGAGG + Intronic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984516953 4:180752829-180752851 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
985278012 4:188257700-188257722 CAGTGAAAGCATGAGGATGGGGG - Intergenic
985341467 4:188959219-188959241 CAGCCAAAGCAGCAGCAGGAAGG - Intergenic
985785481 5:1891397-1891419 CAGAGAACTCAGCCTGAGGGCGG - Intergenic
985851626 5:2392626-2392648 AAGAGAAAGAGGAAGGAGGGAGG - Intergenic
985899663 5:2778794-2778816 CAGAGAACGGTGCAGCAGGGAGG + Intergenic
985923615 5:2998858-2998880 CAGAGACAGCAGGAGGGGAGAGG + Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986283831 5:6345593-6345615 CAGAGAACAGAGGAGGAGGGAGG + Intergenic
986323359 5:6652118-6652140 CAGAGAAAGCAGCAGCACCCCGG + Intronic
986339526 5:6777305-6777327 CAGAGAAAGCAGAGGGATGAAGG - Intergenic
986512017 5:8517428-8517450 CAGAGCAAGCAGAAGCAGGGTGG - Intergenic
986628947 5:9750313-9750335 TTAAGAAAGCAGCAGGATGGTGG - Intergenic
986942807 5:12975903-12975925 CAGAGAAAACACCTGGAGTGAGG - Intergenic
987187901 5:15444120-15444142 AGGAGACAGAAGCAGGAGGGAGG - Intergenic
987226008 5:15842133-15842155 CAGTGAAAGCAGCTGGGAGGGGG + Intronic
987962772 5:24831934-24831956 CAGAGAACACAGCAGGAGCTAGG - Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989987205 5:50714780-50714802 CACAGTCAGCTGCAGGAGGGAGG - Intronic
990723215 5:58722356-58722378 CAGAGAAGGCAGCAGGCATGGGG + Intronic
990868320 5:60403751-60403773 GAGAGACAGCATCAGGAAGGAGG - Intronic
990903535 5:60779139-60779161 CAGTGAAAGCAGCAGGAAAGGGG - Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991398108 5:66225592-66225614 CAGGGAAAGAAGCAGGAGTTTGG + Intergenic
991647755 5:68818442-68818464 CAGAGAAGACTGCGGGAGGGAGG + Intergenic
991976489 5:72188331-72188353 GAGAGAAAGCTGCAGAAGGCTGG + Intronic
992669158 5:79041696-79041718 AAGAGAAAGCTCCAGGAGGCCGG + Intronic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993391385 5:87322539-87322561 CAGAGAGAGCAAGAGAAGGGGGG - Intronic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
995054958 5:107748682-107748704 CAAAGAAACTAGCAGTAGGGAGG - Intergenic
995392356 5:111653173-111653195 CCGTGAAAGCAGCTGGGGGGAGG - Intergenic
995533529 5:113113783-113113805 GAGACAAAACAGCAGGAGGGAGG + Intronic
995847182 5:116506665-116506687 GAGAGAAAGCATCTGGCGGGAGG + Intronic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996507472 5:124284545-124284567 CAGAGATGGGAGCAGTAGGGTGG + Intergenic
997212624 5:132086429-132086451 CAAAGGAAGCTGCAAGAGGGAGG + Intergenic
997217924 5:132129718-132129740 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
997596466 5:135110479-135110501 TAAAGAAAGCAGCAGGATGAGGG - Intronic
997606567 5:135179275-135179297 TAGAGAAGGCTGCAGGAGAGGGG + Intronic
998161381 5:139814662-139814684 CAGAGAAGCCAGCAGGAGCTGGG + Intronic
998205499 5:140154335-140154357 CAGAGCAAGCAGGAGTGGGGAGG - Intergenic
999033024 5:148315417-148315439 CAGAGGAGGCAGCAGAGGGGTGG + Intronic
999374039 5:151074306-151074328 CAGAGACAGACGCAGGAGGATGG + Intronic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
1000286751 5:159833466-159833488 TAGGGAAAGCAACAGGAAGGAGG - Intergenic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1001706091 5:173742017-173742039 CAGTGCAAGAAGCAGGTGGGAGG + Intergenic
1001732160 5:173968567-173968589 TAGAGAAAGAATCAGGAGGTGGG + Intergenic
1002017505 5:176336803-176336825 CAGAGACAGAGGCAGGCGGGTGG - Exonic
1002038368 5:176491252-176491274 CAGAGAAGGCAACAGGACAGAGG - Intronic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002181247 5:177432174-177432196 CAGGGCAAGCAGCAGGTGTGGGG - Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1002547065 5:179956190-179956212 CAGAGAGGGCAGCAGGAGCTCGG - Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002892974 6:1352805-1352827 CCATGAAAGCAGCTGGAGGGAGG - Intergenic
1003142219 6:3481150-3481172 AAGTGAAGGCAGCAGGAAGGGGG - Intergenic
1003389821 6:5703964-5703986 CAGAGGAAGGAGGAAGAGGGAGG - Intronic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1003571432 6:7258777-7258799 CAGAGAGGGCACCTGGAGGGTGG + Intergenic
1003690258 6:8346709-8346731 CTGTGAAAGCAGCTGGAAGGGGG + Intergenic
1003759693 6:9162778-9162800 AAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1005231312 6:23704645-23704667 CAGGGGAAGGAGTAGGAGGGAGG + Intergenic
1005518433 6:26576724-26576746 CAGACAAAACAGCAGGACAGAGG + Intergenic
1005867752 6:29948953-29948975 CAGAGGAAGCAGTAGCTGGGTGG - Intergenic
1006185026 6:32176641-32176663 CAGAGAAGGCAGGTGGAGGGGGG - Exonic
1006499580 6:34449303-34449325 CACAGAAGACAGCAGGAGTGAGG - Intergenic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1007229239 6:40336868-40336890 CAGAGCAACCAGAAGGATGGGGG + Intergenic
1007287369 6:40757363-40757385 CAGAGAGAGAAGCAGGTTGGTGG + Intergenic
1007370746 6:41425644-41425666 CAGAGAAAGCCTCAGCAGAGAGG + Intergenic
1007696224 6:43735936-43735958 CAGACAAGGCTGCAGGTGGGTGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008198733 6:48559850-48559872 CAAAGAAAGCAGGAGGAAGTGGG - Intergenic
1008627530 6:53332551-53332573 CACAGAACGGAGCAGGAGGAGGG + Intronic
1008654148 6:53594127-53594149 GAGAGAAGGATGCAGGAGGGTGG + Intronic
1009564427 6:65293979-65294001 GAGAGAAAGCAAATGGAGGGGGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011744600 6:90397290-90397312 CAGAGCAATTAGCAGGAGGGAGG - Intergenic
1012133013 6:95519785-95519807 AAGCGAAGGCAGCAGGAGGCCGG + Intergenic
1012431915 6:99172862-99172884 CCAAGAGAGCAGTAGGAGGGAGG - Intergenic
1013279572 6:108622977-108622999 CAGTGGAAGCAACAGGAGGGTGG + Intronic
1013327612 6:109063271-109063293 AAGAGAAATAAGTAGGAGGGTGG + Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1013657588 6:112261504-112261526 CTGAGAGAGCAGTAGGAGGCTGG - Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014770404 6:125453076-125453098 CAGAGCAGGCACCAGGAGTGGGG - Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1015241074 6:131024214-131024236 AAGAGAAAGCAGGCAGAGGGAGG + Intronic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016125371 6:140395763-140395785 AACAGTGAGCAGCAGGAGGGAGG - Intergenic
1016166061 6:140945122-140945144 CTGTGAAAGCAGCAGGAGGAAGG + Intergenic
1016239401 6:141911069-141911091 CAGAGAGATCTGCAGGAGGTTGG + Intergenic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016802814 6:148183670-148183692 CAGACACAGCAGGAGGAGGACGG + Intergenic
1016905965 6:149151198-149151220 CACTGAAAGCAGCAGTGGGGAGG + Intergenic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017577232 6:155818459-155818481 CAGAGAAAGCAAGAGGAAGGAGG + Intergenic
1017586940 6:155936878-155936900 TAGAGAGAGAAGGAGGAGGGAGG + Intergenic
1017600010 6:156070036-156070058 CAAAGAGAACAGCAGGAGCGAGG - Intergenic
1017622962 6:156317775-156317797 CTGGGAAAGCCCCAGGAGGGGGG - Intergenic
1017652070 6:156593122-156593144 GAGAGAAAGAAGGAAGAGGGAGG + Intergenic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018432185 6:163730988-163731010 CACAGCAGGAAGCAGGAGGGAGG + Intergenic
1018951657 6:168382238-168382260 GACAGAAAGCAGCAGGCGGGGGG - Intergenic
1018963454 6:168465241-168465263 CACAGAAAGCAGCGGCAGGATGG - Intronic
1019020707 6:168915304-168915326 AGCAGAGAGCAGCAGGAGGGAGG + Intergenic
1019100629 6:169626411-169626433 CAGAGAAGGCAGCAGGAGCCTGG - Intronic
1019257708 7:62382-62404 CCCAGAAAGGAGCTGGAGGGGGG - Intergenic
1019284625 7:217326-217348 TAGAGAAAGCAACAGGAGCCAGG - Intronic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019315361 7:381652-381674 AAGAGAAGGCAGCTGGGGGGTGG + Intergenic
1019377173 7:699038-699060 ATGAGAAAGAAGCAGAAGGGGGG + Intronic
1019444619 7:1064864-1064886 CACAGAAGGCCCCAGGAGGGAGG + Intronic
1019756948 7:2777622-2777644 GTGAGGAAGCAGCAGGAAGGTGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020011513 7:4808084-4808106 GAGAGGAAGAAGGAGGAGGGAGG - Intronic
1020094453 7:5360883-5360905 CTGAGGAAGCAGAAGGAGCGTGG - Intronic
1020180033 7:5915104-5915126 CCGTGACAGCAGGAGGAGGGAGG + Intronic
1020302901 7:6809778-6809800 CCGTGACAGCAGGAGGAGGGAGG - Intronic
1020430599 7:8113020-8113042 CAGATAAGGCAGCAGCAGGAAGG - Intergenic
1020950614 7:14671270-14671292 CAGAGAAAGGACCAGGAGTGAGG + Intronic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1021362095 7:19728180-19728202 GAGAGAAAGAAAGAGGAGGGAGG - Intronic
1021423863 7:20476318-20476340 AAGAGAAGGCAGCAGTGGGGCGG + Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022723730 7:32962859-32962881 GAGAAAAAGCAGTAGGAGTGAGG + Intronic
1022909100 7:34882915-34882937 CTATGAAAGCAGCGGGAGGGGGG - Intergenic
1022991663 7:35714627-35714649 AAGAGAAGGCAACAGGAGGCAGG + Intergenic
1023086160 7:36571726-36571748 AAGAGACAGCAGCAGGCAGGAGG - Intronic
1023155582 7:37248420-37248442 CAGAGAAAGCAAAAGGAGTGAGG + Intronic
1023363650 7:39441425-39441447 CAGAGAAAGCAAGAGGAGCAAGG + Intronic
1023366399 7:39468284-39468306 CGGAGCAGGCAGCAGGAGGGAGG + Intronic
1023723080 7:43114552-43114574 CAGAGGAAGCAGCAAGCGGAGGG - Intronic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1025033291 7:55574165-55574187 CAGAGAGAGATGCAGAAGGGAGG - Intergenic
1025049894 7:55725056-55725078 GAGAAAAAGCAGTAGGAGTGAGG - Intergenic
1025237199 7:57242862-57242884 CACACAGAGCAGCAGGAAGGGGG + Intergenic
1025605788 7:63039013-63039035 CCCAGGAGGCAGCAGGAGGGGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026445698 7:70482783-70482805 TAGAGAAAGCAGCAGGAATGGGG - Intronic
1027853481 7:83479207-83479229 CAGAGAAAGCAGGGGTAGGAAGG - Intronic
1027929497 7:84513144-84513166 CAGAGAAAGAAGCACAAGGTTGG + Intergenic
1028378966 7:90176825-90176847 CAGAGCAGGCACCAGGAGTGGGG + Intronic
1028486125 7:91359497-91359519 CAGAGATAGCAGCATAATGGAGG + Intergenic
1029361074 7:100089032-100089054 CGGAGGAAGCAGCGGGATGGAGG + Exonic
1029528246 7:101108615-101108637 CAGAAACAGCAACAGGTGGGGGG + Intergenic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1029655879 7:101924131-101924153 CAGAGATAGCATCAGGTGCGTGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1031270361 7:119641695-119641717 CAGAAGAAGCAGCAGGAGCAGGG - Intergenic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031903065 7:127430581-127430603 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1032075459 7:128833783-128833805 GAGAGAAAGCACCGGGAGGCAGG + Intronic
1032131357 7:129230984-129231006 CTGAGAAAGCAGCCTGAGGTGGG + Intronic
1032219314 7:129982043-129982065 CAGAGAAGGCATGAGGAGAGGGG + Intergenic
1033347963 7:140540207-140540229 AAGAGAAGGCAGCAGGAACGTGG - Intronic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033628866 7:143138056-143138078 CTGAGCAAGCTGCAGGAGGTGGG + Intronic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1033767575 7:144510917-144510939 CAGAAATATCAGCAGGAAGGTGG + Intronic
1033783934 7:144706971-144706993 TAGCGAAAGCAGGTGGAGGGAGG + Intronic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034904752 7:154934260-154934282 CCGTGAAAGCAGCTGGCGGGGGG - Intronic
1034940293 7:155226358-155226380 CTGAGAAAGCTGCAGATGGGAGG + Intergenic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037327379 8:17706354-17706376 AATAGAAAGCAGCAGGACGAAGG + Intronic
1037419930 8:18691119-18691141 CATACAAAGCAACAGGATGGGGG + Intronic
1037807008 8:22063645-22063667 TAGAGAAAGCAGCATAAGGTGGG - Intronic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1037835640 8:22213410-22213432 CAGAGGAAGCAGCAGCAGGGAGG - Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1037916047 8:22774056-22774078 CTGTGAAACCAGCAGGAGGGAGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038266533 8:26043053-26043075 CAGAAAACGCAGCATGAGTGGGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038675243 8:29617040-29617062 CGGAGAAAGCTTCAGGAGGTGGG - Intergenic
1038848530 8:31252026-31252048 GAGAGAAAGCAGATGGAGAGCGG - Intergenic
1039187164 8:34930404-34930426 GAGAGAGAGAAGAAGGAGGGAGG + Intergenic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039411733 8:37360463-37360485 GAGAGGCAGCAGCAGGAGAGAGG + Intergenic
1039796183 8:40917586-40917608 CAGAGAGAGCAACAGGAGCGTGG + Intergenic
1039915887 8:41860005-41860027 CAGAGAAAGCAACTGGAGCAAGG + Intronic
1039957267 8:42217252-42217274 CAGAGAAGGAAGCAGCAGTGGGG + Intergenic
1040911066 8:52519709-52519731 CAGAGTAAGTAGCAGGAGATGGG - Intergenic
1040924861 8:52669411-52669433 TAGAGAAGGCAGCATGAAGGAGG - Intronic
1040931528 8:52740215-52740237 CAAAGAAAACAGGAAGAGGGTGG + Intronic
1041464217 8:58142755-58142777 CAGAGAACACAGCCTGAGGGTGG - Intronic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1042346367 8:67732180-67732202 GGGAGAAATCAGCAGGAGAGTGG + Intronic
1042625018 8:70748389-70748411 CAGAGAAGGCGCCAGGAGCGGGG - Intronic
1044364423 8:91326410-91326432 GTGAGGAAGCAGCAAGAGGGAGG - Intronic
1045227082 8:100259227-100259249 CAGAGAAGGCAACAGTATGGAGG - Exonic
1045680337 8:104652969-104652991 CTGAGCAAACAGCAAGAGGGCGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045703291 8:104891986-104892008 CAGACACAGCTGCAGGAGGTGGG + Intronic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1047508542 8:125498455-125498477 CAGAGACAGCAGCTACAGGGTGG - Intergenic
1048146619 8:131851241-131851263 GAGAGAAAGCATCAGGGGGGTGG - Intergenic
1048297282 8:133223616-133223638 GAGAGAAAGAAACAGGAGGAAGG - Intronic
1048456614 8:134584247-134584269 CAGAGAAAGCTGCAGGGTGGAGG - Intronic
1049343945 8:142128579-142128601 CTGGGAAAAGAGCAGGAGGGTGG + Intergenic
1049356727 8:142192816-142192838 AGGAGAAACGAGCAGGAGGGAGG + Intergenic
1049356804 8:142193077-142193099 AGGAAAAAGGAGCAGGAGGGAGG + Intergenic
1049508559 8:143016464-143016486 CTCAGAAAGCAGGAGGAGGAGGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051298200 9:15618802-15618824 GAGAGCAAGCAGAAGCAGGGTGG - Intronic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051374113 9:16386883-16386905 CAGAGAGACCAGCAGGAGGCAGG + Intergenic
1051808032 9:21018006-21018028 CACAGAAAGCAGCAACAGGATGG + Intronic
1051814241 9:21087068-21087090 GAGGGTAAGCAGAAGGAGGGTGG + Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052783098 9:32801392-32801414 CCTAGAAAGCATCAGTAGGGGGG + Intergenic
1053082103 9:35184789-35184811 AAGAGAAAGAAGCGGGGGGGGGG + Intronic
1053329498 9:37190210-37190232 CAGTGACAGCAGCAGCAGTGGGG - Intronic
1053429128 9:38030395-38030417 TAGAGAAAGCAGCAAGTGGGAGG - Intronic
1053523225 9:38803182-38803204 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1053560343 9:39186329-39186351 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1053824446 9:42006572-42006594 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1054136775 9:61432626-61432648 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054195453 9:62027601-62027623 GAGTGGAAGCAGCATGAGGGAGG - Intergenic
1054606125 9:67180791-67180813 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054642954 9:67561088-67561110 GAGTGGAAGCAGCATGAGGGAGG + Intergenic
1054991469 9:71331945-71331967 AAGAGAAAGGTGGAGGAGGGAGG + Intronic
1055119185 9:72638509-72638531 CAAAATAAGCAGCAGGAAGGGGG - Intronic
1055360212 9:75481577-75481599 CACAGGAAGCAGCCAGAGGGAGG + Intergenic
1056230714 9:84539840-84539862 CACCGAAAGCAGCAGGAAAGAGG - Intergenic
1056958657 9:91102515-91102537 CAGAAAAAGATGCTGGAGGGTGG + Intergenic
1057108501 9:92444737-92444759 CAGGCAAAGCAGCATGGGGGAGG + Intronic
1057130603 9:92651678-92651700 CACAGAAAACAACATGAGGGAGG - Intronic
1057470999 9:95356144-95356166 CAGAGAAAGCAACAGCAGAGAGG - Intergenic
1057480825 9:95444448-95444470 CCAAGACAGCAGCAGGGGGGTGG + Exonic
1057519875 9:95752144-95752166 CTGAGAGGGCAGCGGGAGGGGGG - Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1058552631 9:106131783-106131805 CAGAGAAAGTAACAGTAGTGAGG + Intergenic
1058881072 9:109286258-109286280 GATAGATAGCAGCAGGAGGTGGG + Intronic
1058918218 9:109587874-109587896 CAGAGACTGCAGGAGGAAGGTGG + Intergenic
1059373330 9:113861649-113861671 CAGAGAACTCAGCAGGAGGATGG - Intergenic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1060192968 9:121604509-121604531 CAGAGAAAGAAGAGGCAGGGAGG - Intronic
1060939816 9:127536785-127536807 CAGAGCTAGGACCAGGAGGGTGG - Intronic
1060986859 9:127825071-127825093 CAGAAGACGCAGCAGGAGTGGGG - Intronic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061133592 9:128721418-128721440 GAGGGACAGCAGCAGGAAGGTGG + Exonic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061188775 9:129070102-129070124 CAGAGGAAGCAGTGGGAGGGAGG + Intronic
1061360456 9:130138550-130138572 CAGAGAAGGGAAGAGGAGGGAGG - Exonic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062520690 9:136956642-136956664 CAGAGAAAGCTGCTGAAGGATGG + Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1203437211 Un_GL000195v1:149983-150005 CAGAGACTGAAGCAGGAGGATGG - Intergenic
1185545400 X:939789-939811 AAGAGAAAAGAGGAGGAGGGGGG - Intergenic
1186326688 X:8485504-8485526 CACAGAACGGAGCAGGAGTGTGG + Intergenic
1187025780 X:15434081-15434103 AGGAGAAAGGAGGAGGAGGGAGG + Intronic
1187056230 X:15743748-15743770 CAGGGGATGCAGCAGGAGGTGGG - Intronic
1187265706 X:17731068-17731090 CAGAGAAAGCAAGTGGATGGAGG - Intronic
1187460728 X:19484557-19484579 GGGAGAATGCACCAGGAGGGAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188108943 X:26175019-26175041 CAGAGAATGCAGCAAAAGAGTGG + Intergenic
1188239949 X:27773796-27773818 CAGTGAATGAAGCAGGATGGGGG - Intergenic
1188242956 X:27810990-27811012 CAGAGTATGCAGTTGGAGGGAGG - Intronic
1188475373 X:30586387-30586409 GAGAGGAAGCAACAGAAGGGAGG + Intergenic
1188475733 X:30589668-30589690 GAGAGAAAGCAAGAGGTGGGAGG + Intergenic
1189192502 X:39122646-39122668 CAGAGAAAGCCTGAGAAGGGAGG + Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1190113212 X:47608622-47608644 GAGAGGGAGCAACAGGAGGGAGG + Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1191132703 X:57031301-57031323 GAGAGCAAGCAGAAGCAGGGTGG - Intergenic
1191994696 X:67080358-67080380 CAAAGAAAGCAGCCAGAGAGTGG - Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192552267 X:72063957-72063979 CAGAGAAAGCTTCATGGGGGAGG + Intergenic
1192955446 X:76065088-76065110 CTGAGACAGCACTAGGAGGGTGG + Intergenic
1193040540 X:76999266-76999288 CAGGGTAAGCAGAAGTAGGGTGG - Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1194300645 X:92182061-92182083 CAGTAAAAGCAGCTGGAGGGAGG + Intronic
1194771714 X:97915103-97915125 GAGAGCAAGCCGAAGGAGGGTGG + Intergenic
1194847721 X:98832478-98832500 GAGAGAAAGAAGCAGGAGAAGGG - Intergenic
1194892294 X:99394957-99394979 CAGTGAAAGCAGCAGTAAGAGGG - Intergenic
1195244427 X:102982774-102982796 CAGAGAATGCAGCTTTAGGGTGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1195666634 X:107437342-107437364 CAGAGAAAGCACAAGGCAGGAGG - Intergenic
1197048495 X:122029368-122029390 GAGAGAGAGCAACAGGAAGGTGG + Intergenic
1197147781 X:123188168-123188190 CAGAGAAAGCAACAGGCAGCTGG - Intronic
1197226480 X:123960798-123960820 CTGAGAAAGAAGGAGGAGTGGGG + Exonic
1197370628 X:125621773-125621795 CAGACAAAGCAGCTCCAGGGAGG + Intergenic
1197698335 X:129575229-129575251 CTTAGAACTCAGCAGGAGGGAGG + Exonic
1197761099 X:130028910-130028932 CAGAGGAGGCAGGAGGGGGGTGG + Intronic
1198012827 X:132576265-132576287 CAGAGAAAGTATTGGGAGGGAGG + Intergenic
1198075098 X:133186339-133186361 CAGGGAAAGGAGCAGGAAAGAGG + Intergenic
1198834986 X:140795456-140795478 CTGTGAAAGCAGCCGGGGGGTGG - Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199716338 X:150509567-150509589 CAGAGTATGTAGAAGGAGGGAGG - Intronic
1199854480 X:151749425-151749447 CAGAGAAAACAACCGGAGAGAGG - Intergenic
1200310665 X:155073648-155073670 CAAGGAGAGCAGCAAGAGGGTGG - Intronic
1200740347 Y:6847096-6847118 GAGAGCAAGCAGGAGCAGGGTGG - Intergenic
1200753406 Y:6967773-6967795 GAGAGAGAGCAGAAGGAGTGAGG - Intronic
1201300168 Y:12498411-12498433 GAGAGAAAGAGGAAGGAGGGAGG - Intergenic