ID: 974386079

View in Genome Browser
Species Human (GRCh38)
Location 4:61202491-61202513
Sequence GCTGGTAGTGGGCACTGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974386072_974386079 -8 Left 974386072 4:61202476-61202498 CCCGGGCTGCGCTGTGCTGGTAG 0: 1
1: 0
2: 1
3: 19
4: 213
Right 974386079 4:61202491-61202513 GCTGGTAGTGGGCACTGGGCGGG No data
974386073_974386079 -9 Left 974386073 4:61202477-61202499 CCGGGCTGCGCTGTGCTGGTAGT 0: 1
1: 0
2: 0
3: 10
4: 108
Right 974386079 4:61202491-61202513 GCTGGTAGTGGGCACTGGGCGGG No data
974386070_974386079 8 Left 974386070 4:61202460-61202482 CCACTTTCGTGGGTGGCCCGGGC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 974386079 4:61202491-61202513 GCTGGTAGTGGGCACTGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974386079 Original CRISPR GCTGGTAGTGGGCACTGGGC GGG Intronic
No off target data available for this crispr