ID: 974386171

View in Genome Browser
Species Human (GRCh38)
Location 4:61202949-61202971
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974386167_974386171 -7 Left 974386167 4:61202933-61202955 CCTGGGATCCTCTTAACTGGAAA 0: 1
1: 0
2: 0
3: 10
4: 146
Right 974386171 4:61202949-61202971 CTGGAAAATCTGGTTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr