ID: 974386931

View in Genome Browser
Species Human (GRCh38)
Location 4:61213108-61213130
Sequence CAACAACAACAGAAGTAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 460}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974386928_974386931 9 Left 974386928 4:61213076-61213098 CCTTGAATTTAGGGGATGTTGAG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 974386931 4:61213108-61213130 CAACAACAACAGAAGTAATGGGG 0: 1
1: 0
2: 1
3: 56
4: 460

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974386931 Original CRISPR CAACAACAACAGAAGTAATG GGG Intronic
901519178 1:9769453-9769475 CAGCAACAAAAAAAGGAATGAGG + Intronic
902164281 1:14557107-14557129 CAACAAAAGCAGAAATAACGTGG + Intergenic
902175246 1:14645069-14645091 CAAAACTAACAAAAGTAATGGGG - Intronic
904791261 1:33023424-33023446 CAACAACAACAAAAGTAGCAGGG + Intronic
905562608 1:38939513-38939535 CAACAACAACAAAAGTTAGCTGG + Intronic
906678951 1:47712025-47712047 CAGCATCAACAGAAGCAATGCGG + Intergenic
906943932 1:50279404-50279426 CAACAACCTGTGAAGTAATGAGG - Intergenic
907107970 1:51901258-51901280 TAAAAACAACAAAAGTACTGTGG - Intergenic
907331284 1:53673209-53673231 CAACAACAACAAAAATTCTGTGG - Intronic
907589170 1:55649522-55649544 CAACAACAACAAAAGAAAACAGG - Intergenic
907721492 1:56976386-56976408 CAACAACAAAAAAGGTAATTGGG - Intergenic
908071202 1:60462293-60462315 CAATAATAAAAGAATTAATGAGG - Intergenic
908551603 1:65214087-65214109 CAACAACAACAACAAAAATGAGG - Intronic
909361098 1:74759636-74759658 CAACAACAACAAAAGCCATGTGG - Intronic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
910168042 1:84348584-84348606 AAACAATAACAAAAATAATGTGG + Intronic
910766158 1:90784468-90784490 CAAAAACAAAAGAAGCAGTGTGG + Intergenic
911088382 1:93998519-93998541 CAACAAAAAAAGAAATACTGGGG + Intronic
911887283 1:103319829-103319851 CAACAACAACAAAAGAAAGATGG - Intergenic
912243973 1:107941590-107941612 CAAACAAAACAGAAGTACTGAGG - Intronic
912649614 1:111426230-111426252 CAGCAACTACAAAAGTAAGGAGG + Intronic
913431915 1:118804589-118804611 TAACATCAACAGAGGAAATGTGG - Intergenic
914328296 1:146642333-146642355 CAACAACAGCAAAAGAAAAGAGG - Intergenic
914848304 1:151295015-151295037 GAACAACAACAGAAGCAAGCAGG + Intronic
914873991 1:151498938-151498960 CAAGAACAACTGCAGCAATGGGG - Intergenic
915000898 1:152589693-152589715 CAACAACAAGAAAAGTCAAGTGG + Intronic
915861336 1:159447841-159447863 CAACAACAACAAAAATTATAAGG + Intergenic
916927485 1:169538586-169538608 CAACAACAACAAAAAAACTGGGG + Intronic
917594138 1:176510947-176510969 GAACAAAAAAAGAATTAATGGGG + Intronic
918145817 1:181754621-181754643 GAAGACCAATAGAAGTAATGTGG - Intronic
918860658 1:189822277-189822299 CAACAACAACAAAAATACTAAGG + Intergenic
918917171 1:190657716-190657738 CAAGAAGAAAAGAAATAATGAGG + Intergenic
920069701 1:203293580-203293602 TAACGACAACAGAAGTAATCAGG - Intergenic
920313538 1:205062203-205062225 CAGCCACAAAAGAAGTGATGTGG + Intronic
920454586 1:206089495-206089517 AAACAAAAACTGAAGAAATGAGG - Intronic
922212004 1:223493566-223493588 CAACAACAACAACAGAAAAGGGG + Intergenic
923168431 1:231389970-231389992 CAACAACAACAAAAGAACAGTGG + Intronic
923625164 1:235607755-235607777 CCACAAGAGCAGAAGTCATGAGG + Intronic
923663659 1:235980002-235980024 CAAAAAAAACAAGAGTAATGAGG + Intronic
923696732 1:236260150-236260172 CAACAAAATCAGAATTAAAGAGG + Intronic
924683332 1:246260413-246260435 CAACAACAACAAAAGGAAAATGG - Intronic
1062794779 10:336344-336366 CACCACCAACACAAGTAACGTGG - Intronic
1064000101 10:11656690-11656712 CAACAACAACAAAAGTTCAGAGG - Intergenic
1064556860 10:16555493-16555515 CAACAACAACAAAAATACTTAGG - Intergenic
1064820493 10:19324887-19324909 AAAAAAAAACAAAAGTAATGGGG - Intronic
1064969148 10:21046589-21046611 AAACAAAAACAAAAGTATTGAGG - Intronic
1065147318 10:22782701-22782723 CAACAACAACAAAAATAAGGTGG + Intergenic
1065519598 10:26558798-26558820 CAGAAACAACAGAAGCAATGAGG + Intronic
1068148304 10:53099136-53099158 CAACAAAAACAAAATTAATGTGG - Intergenic
1068170740 10:53390750-53390772 ATACAACAACAAAAATAATGTGG + Intergenic
1068351415 10:55850519-55850541 TATCAATAACAGAAGTGATGGGG - Intergenic
1068739604 10:60453620-60453642 AAACAAAGACAAAAGTAATGAGG - Intronic
1070081055 10:73188090-73188112 CAACAACAACAAAAACAGTGTGG + Intronic
1070129157 10:73644870-73644892 TAACAGCAACAGAAGGTATGGGG + Exonic
1070492010 10:76986225-76986247 CAACAACAAAATAACTCATGCGG + Intronic
1070949056 10:80416414-80416436 CAAGCACATCAGAAGAAATGTGG + Intronic
1072789094 10:98304496-98304518 CAACAAAACCAGAGGTGATGTGG - Intergenic
1072883658 10:99253365-99253387 CAACAACAAAAAAAGCAATGGGG + Intergenic
1073348977 10:102805735-102805757 CAACAACAACAAAATTAGTGGGG + Intronic
1073454018 10:103625892-103625914 CAACAACAACAAAAAGAATGTGG + Intronic
1074670398 10:115784023-115784045 CAACAACAACAAAAATGATTCGG + Intronic
1076933367 10:133549964-133549986 CAAAAAAAAAAAAAGTAATGGGG + Intronic
1079581017 11:22065036-22065058 CATCAACAGCAGAATTGATGAGG + Intergenic
1079694513 11:23463409-23463431 GAACAACAAGAGAAGAAATATGG + Intergenic
1079694867 11:23468850-23468872 AAAAAACAACAACAGTAATGTGG - Intergenic
1080833793 11:35921063-35921085 CAACAACAACAAAAAAAATCAGG - Intergenic
1080891020 11:36409367-36409389 CAACAAGAACAGAAGCAGGGTGG - Intronic
1081076816 11:38685550-38685572 AACCAACAACAGAAGGAACGAGG - Intergenic
1082734106 11:56837595-56837617 CAACATCAACAGCATTAGTGAGG - Intergenic
1082966719 11:58973360-58973382 CAACAGCAACAGAAGAAAGCTGG + Intronic
1085048085 11:73364762-73364784 CATCAGCTACAGAAGAAATGAGG - Intronic
1085072086 11:73556043-73556065 GAACAACAAAAAAAGCAATGGGG + Intronic
1085451532 11:76637067-76637089 CTACAGCAACAGGAGGAATGGGG - Intergenic
1085660372 11:78359731-78359753 CAACAATAACATAAGTTAGGAGG + Intronic
1086256890 11:84888016-84888038 CAACAACAACAACAATACTGTGG + Intronic
1086393962 11:86395223-86395245 CAACAACAAGAAAAGTATCGTGG + Intronic
1086480070 11:87225539-87225561 AAACAAGAAAAGAATTAATGTGG + Intronic
1087080026 11:94161740-94161762 CACCAGCAACAGAAGAAATCTGG - Intronic
1087482763 11:98721988-98722010 GAAGAACTACAGAAGCAATGGGG + Intergenic
1088609542 11:111564038-111564060 CTACAAGCTCAGAAGTAATGTGG - Intergenic
1088718280 11:112569394-112569416 CAACAAAAACAGAAGTCTTATGG - Intergenic
1089172282 11:116521239-116521261 AAACTACAACAAAAGAAATGAGG + Intergenic
1089428668 11:118402109-118402131 GAACAACACCACATGTAATGAGG - Intronic
1089521080 11:119064006-119064028 CAACAACAACAAAATTAACTGGG + Intergenic
1089537915 11:119172112-119172134 GAACAAAAACAGACGTAAAGGGG + Intronic
1089568815 11:119388647-119388669 AAACTACGACAGAAGCAATGTGG - Intergenic
1090366055 11:126206610-126206632 GAACACCAACAGAAGTGATTTGG - Intronic
1090694049 11:129218742-129218764 CAACAACAACAAAACTATTCAGG + Intronic
1090867527 11:130714940-130714962 CAACAACAACAGCAACAATTAGG - Exonic
1091456187 12:609794-609816 AAACAACAACAGCAGCAATAGGG + Intronic
1092814543 12:12301430-12301452 CAACAACAACAAAAAAAGTGGGG - Intergenic
1093093181 12:14943647-14943669 GAACAACAACAGCAGTAAGTTGG + Intronic
1093828582 12:23726545-23726567 CAACAACAACAGAAAGATTTGGG - Intronic
1094709158 12:32943706-32943728 CAACAACAACAAAAGTAGCTGGG + Intergenic
1095190489 12:39252085-39252107 AAACAAAAACATAAGTAGTGAGG + Intergenic
1095206498 12:39444676-39444698 CATCAACAAAAGAAGCAAGGTGG - Intergenic
1095524291 12:43106662-43106684 TAACAACAACAGCAGTAAGAAGG - Intergenic
1096068547 12:48760502-48760524 CAACAACAGCAAAACCAATGAGG - Intergenic
1096247373 12:49999734-49999756 CTGCAACAAAAGTAGTAATGAGG + Intronic
1097002223 12:55886645-55886667 CAACAACAACAAAATTAATCAGG + Intergenic
1097272123 12:57782537-57782559 AAACAACAACACAAGAAATGTGG - Intronic
1097957712 12:65503559-65503581 CAACAACAACAGTATTTATCAGG + Intergenic
1098252088 12:68580549-68580571 CAACAACAAAAAAAGAAATCAGG + Intergenic
1098516104 12:71377789-71377811 CAACAACAACAACAAAAATGAGG + Intronic
1098963201 12:76760556-76760578 TAATAACAACAGAAGAAACGTGG + Intergenic
1099163785 12:79276380-79276402 CAAAAAAAACAGAATTAGTGGGG + Intronic
1099563459 12:84209292-84209314 CAACAAAAATATAAATAATGGGG + Intergenic
1100335573 12:93626003-93626025 AAGCAACAACAGAAGCAATTGGG + Intergenic
1100370582 12:93965683-93965705 CAACAACAACAAAATTAAAGTGG - Intergenic
1100860665 12:98802794-98802816 CAACGAAAACAAAACTAATGTGG - Intronic
1100920630 12:99482043-99482065 CAACAAAAACAAAAGTAAATGGG - Intronic
1100998872 12:100334253-100334275 CAAGAACAGCAGAAGTAAGTAGG + Exonic
1102459032 12:113088829-113088851 CAACAACAACAAAACTTTTGAGG - Intronic
1103185050 12:118949468-118949490 CAACAACAACAAAAGAGAAGTGG - Intergenic
1103267132 12:119640134-119640156 CAACAACAACAAACAAAATGCGG - Intronic
1105554086 13:21428911-21428933 CAACAACAACAAAAATTATTAGG + Intronic
1106015899 13:25868807-25868829 CAACAACAACAAAAGCACTTTGG + Intronic
1106317116 13:28604089-28604111 CAACAACAACAAAAATAAATTGG + Intergenic
1106547688 13:30744643-30744665 GAACAAGAACAGAAAGAATGGGG + Intronic
1107408356 13:40136320-40136342 CAACAACAACAAAAACACTGTGG - Intergenic
1107570377 13:41651162-41651184 CAACAAAAAAAAAAGCAATGGGG + Intronic
1108393173 13:49968070-49968092 CAACAACAAAAGAACTAAGTTGG + Intergenic
1109097176 13:58133660-58133682 CAACAACAACAGTAATGATATGG - Intergenic
1110122508 13:71900765-71900787 CAACAACAAAAAAAGTAAAGTGG - Intergenic
1110664737 13:78103634-78103656 CAACAACAAAACAAGAAAAGAGG + Intergenic
1110890903 13:80696460-80696482 CAACAACAACAAAAAGAATTTGG + Intergenic
1111036802 13:82685015-82685037 CTACAACATCAGAAGTAAGGGGG + Intergenic
1114130955 14:19791692-19791714 TAACAAGAAAGGAAGTAATGTGG - Intronic
1114639768 14:24211671-24211693 CAAGAATAAGAGAGGTAATGAGG - Exonic
1115072850 14:29346898-29346920 AAAAAACCACACAAGTAATGGGG + Intergenic
1116335880 14:43655851-43655873 CAACAACAACAAAACAAATCTGG + Intergenic
1116353107 14:43891654-43891676 CAACAAACACAGAAGTCCTGAGG + Intergenic
1116865323 14:50027110-50027132 AAACAAAAACAAAAGAAATGGGG + Intergenic
1117674795 14:58144565-58144587 CAACAACAACAAAACATATGAGG + Intronic
1117785794 14:59283435-59283457 GAACAACCAGAGAAGCAATGAGG - Intronic
1118552501 14:66970992-66971014 CCACATAAACAGAAGTAATTTGG - Intronic
1119507628 14:75186508-75186530 CAACAACAACAAAATTTATTAGG + Intergenic
1119776505 14:77252374-77252396 CAACAACCAAAGGAGTCATGTGG - Intronic
1120505140 14:85346480-85346502 CAACAACAACAAAATTAACCAGG + Intergenic
1120535618 14:85691493-85691515 CAACAAACACAGAAGCCATGTGG - Intergenic
1120771283 14:88383145-88383167 CCCCAACAACAAAAGTAATTTGG - Intergenic
1120825577 14:88951874-88951896 CAACAACAACACAAGTTATATGG + Intergenic
1121247719 14:92474468-92474490 CAACAACAACAAAACAAATGTGG - Intronic
1122571411 14:102705122-102705144 CAACAACAACAAAAAAAAAGAGG + Intronic
1123432966 15:20233984-20234006 CAACAACAAAAGAAATTATTTGG + Intergenic
1123574010 15:21647312-21647334 GATCAAGAAAAGAAGTAATGTGG - Intergenic
1123610626 15:22089897-22089919 GATCAAGAAAAGAAGTAATGTGG - Intergenic
1123679133 15:22745150-22745172 CAACAACAACAAATGTAAGAAGG + Intergenic
1124331352 15:28819600-28819622 CAACAACAACAAATGTAAGAAGG + Intergenic
1125127965 15:36246660-36246682 TTACAACAAAAGAAGAAATGGGG + Intergenic
1125551645 15:40549551-40549573 CAACTTCCACAGAATTAATGAGG + Intronic
1125753084 15:42043622-42043644 CAACAACAACAGAAGTTCACAGG + Intronic
1126086555 15:45015947-45015969 AAACAACAAAAAAAGCAATGGGG - Intergenic
1128630241 15:69257951-69257973 CTACAACAACAAAAAGAATGGGG - Intronic
1129181438 15:73879866-73879888 CAACAACAACAACAGGAGTGAGG - Intronic
1130405151 15:83592857-83592879 AAACAAAAACAGAAGAGATGAGG - Intronic
1130655592 15:85790082-85790104 CAACAACAACAAAAGAAGTCAGG - Intronic
1131251625 15:90834637-90834659 CAACAACAATAAAAGAATTGTGG - Intergenic
1131384886 15:91996719-91996741 CAACAACACTACAATTAATGAGG + Intronic
1131531623 15:93198354-93198376 GAAAAACAAAAGAACTAATGGGG - Intergenic
1202982875 15_KI270727v1_random:381657-381679 GATCAAGAAAAGAAGTAATGTGG - Intergenic
1133821364 16:9239617-9239639 CAACAACAAGAGAAGAAAGTGGG - Intergenic
1136033525 16:27520713-27520735 CAACAACAAAAAAAGCATTGGGG - Intronic
1136851660 16:33617132-33617154 CAACAACAAAAGAAATTATTTGG - Intergenic
1136908331 16:34123007-34123029 CAACAACAACAAATGAAAAGAGG + Intergenic
1137016993 16:35387397-35387419 CAACAACAACATAAGGGAAGTGG - Intergenic
1137055277 16:35743010-35743032 CAACACCCACAATAGTAATGGGG + Intergenic
1139093597 16:63678523-63678545 AAACAACAACAAAACTAATCTGG + Intergenic
1139123725 16:64052211-64052233 CAACAACAACAACAGTAAGCAGG + Intergenic
1139535007 16:67566552-67566574 CAAGAACAACAAAACAAATGTGG - Intronic
1139699125 16:68696420-68696442 CAACAACAACAAAAATGATTAGG + Intronic
1139714084 16:68798760-68798782 CACCCCCAGCAGAAGTAATGGGG - Intronic
1139793882 16:69465839-69465861 CAAATATCACAGAAGTAATGAGG + Exonic
1140005267 16:71068608-71068630 CAACAACAGCAAAAGAAAAGAGG + Intronic
1140170841 16:72602326-72602348 ATACAACAATAGAAATAATGTGG + Intergenic
1140231402 16:73120244-73120266 CAACAACAACAAAAATAGTATGG - Intergenic
1140237776 16:73174302-73174324 CAACAACAAAAGGAGGAATAAGG + Intergenic
1140588491 16:76322997-76323019 CAACAACAACAAAAAAAATTAGG - Intronic
1203113261 16_KI270728v1_random:1465601-1465623 CAACAACAAAAGAAATTATTTGG - Intergenic
1143358638 17:6349905-6349927 CAACAACAACAAAAGTGACTGGG - Intergenic
1143717386 17:8784497-8784519 CAAAATCAACAGAAGTGAAGAGG - Intergenic
1144712666 17:17412577-17412599 CAAAAACAAAAGATGTGATGAGG - Intergenic
1146757878 17:35449064-35449086 CAACAACAACAAAATTACTCAGG + Intergenic
1148551305 17:48552156-48552178 CACTAGCAACAGCAGTAATGGGG - Exonic
1148929113 17:51113694-51113716 CAACAACAACAAAAGAAAATAGG + Intronic
1148939820 17:51198796-51198818 CAACAACAACAAAAATCACGTGG - Intronic
1149314804 17:55428906-55428928 CAACAACAACAAAAAAAAAGAGG + Intergenic
1149767762 17:59294217-59294239 CAACAACAACAGAATTCTTCAGG + Intergenic
1149838705 17:59938371-59938393 CAACAACAACAAAAAAAATTAGG - Intronic
1150282083 17:63934633-63934655 CAACATCAAAATAAGGAATGGGG + Intergenic
1150297605 17:64021584-64021606 CAACAACAACAAAAACACTGAGG - Intergenic
1150571676 17:66392232-66392254 CAACAACAAAAAAAAAAATGTGG + Intronic
1151053011 17:71000710-71000732 AAACAATAACATAAGTAAAGTGG - Intergenic
1151218709 17:72595258-72595280 GAACAACAACTTAAGTAAAGTGG + Intergenic
1151692809 17:75697281-75697303 CAGCAACAACAAAAGCAAGGAGG - Intronic
1152900071 17:82936013-82936035 AAGCAACAACAGAAGCAAGGAGG - Intronic
1152997084 18:417854-417876 CAGCAACATTAGAAGAAATGGGG - Intronic
1153055302 18:939968-939990 CAACAACAACAAAACTTATTCGG + Intergenic
1153082576 18:1245645-1245667 TAAAAACAACAGAAGTAGGGAGG + Intergenic
1153802369 18:8682527-8682549 AAACAAAACCAGAAGTAAAGAGG + Intergenic
1154089798 18:11346360-11346382 CAACAACAACAGAAATCTAGAGG + Intergenic
1154937092 18:21072121-21072143 TAACAACAACAAAAGTACTTTGG - Intronic
1155286108 18:24290724-24290746 CAACAACAACAAAATAGATGAGG + Intronic
1158119623 18:54034161-54034183 CAACAACATTAGATGTACTGAGG + Intergenic
1159194432 18:65094309-65094331 CAACAAAAACAGAAGAAACAGGG + Intergenic
1159715170 18:71812768-71812790 CAACAACAACAAAAACAATGGGG + Intergenic
1159875788 18:73809422-73809444 CAACAACAACAAAAGAAAAATGG + Intergenic
1161941298 19:7406071-7406093 CAACAACAACAAAAAGAATCTGG - Intronic
1162245284 19:9394912-9394934 CAAAAAGAAAAGAAATAATGGGG + Intergenic
1163985361 19:20942126-20942148 CTACAATAACAAAAGCAATGTGG - Intronic
1164239060 19:23367651-23367673 CAACAATAACAAAAACAATGAGG + Intronic
1164766116 19:30772327-30772349 CAACAAGAAGAGAAATAAGGAGG - Intergenic
1165029214 19:32985334-32985356 CAACAACAAAAGAAATTATTTGG + Intronic
1165766836 19:38356848-38356870 CAGCTACAACACAGGTAATGAGG + Exonic
1166575454 19:43833328-43833350 CAACACCATCATAACTAATGAGG + Intronic
1167246267 19:48374984-48375006 CAACAACAAAAAAAGAAATGTGG + Intronic
925132876 2:1505579-1505601 CAACAACAACAAAAGGAGTGGGG - Intronic
926312661 2:11685892-11685914 CAACCCCAAAAGAAGAAATGGGG - Intronic
926855022 2:17246179-17246201 CAACAACAAAAAAAATAATGCGG + Intergenic
928049535 2:27975860-27975882 CAACAACAATAAAAAAAATGGGG + Intronic
928341160 2:30444140-30444162 CAACAACAACAAAAAAGATGGGG + Intergenic
928664093 2:33533184-33533206 CACCTAAAACAGAAGTCATGAGG - Intronic
929237022 2:39616234-39616256 CAACAATAACAAAAGTAAGAGGG + Intergenic
929696633 2:44122654-44122676 CAACAACAACAAAAGTACTTGGG - Intergenic
929934304 2:46283211-46283233 CAACAACAACAATAATAGTGGGG + Intergenic
930389819 2:50746583-50746605 CAACAACAACAACAAAAATGTGG + Intronic
930469755 2:51797113-51797135 CAACAACAACAAAAGTATTCAGG + Intergenic
930525736 2:52527076-52527098 CAACAACAACAACTGAAATGAGG - Intergenic
930857068 2:56030251-56030273 CAACAACATCAGCAGTTTTGGGG - Intergenic
930924977 2:56806551-56806573 CAACAACAACAAAAATACTAAGG + Intergenic
933146312 2:78857901-78857923 CACCAAGAAAAGAAGTACTGTGG + Intergenic
934162265 2:89261054-89261076 AAACAAAAACACAAGCAATGAGG + Intergenic
934205016 2:89921307-89921329 AAACAAAAACACAAGCAATGAGG - Intergenic
934678167 2:96264956-96264978 GAATAACATCAGAATTAATGAGG + Intronic
935033293 2:99343422-99343444 CAACAACAACAAAAATAAACTGG - Intronic
935167183 2:100579917-100579939 CAACAACAAAAAAATTAGTGGGG - Intergenic
935320368 2:101881832-101881854 CAACAACAACAAAAATGATGGGG - Intronic
935998440 2:108800253-108800275 CAACAACAACAAAAAAAGTGAGG - Intronic
936136044 2:109894848-109894870 AAACAACAAAGGAACTAATGTGG - Intergenic
936208653 2:110476637-110476659 AAACAACAAAGGAACTAATGTGG + Intergenic
936266440 2:111013221-111013243 TAACAACAACAAAAAAAATGGGG + Intronic
936939106 2:117864859-117864881 GAAAAATAACAAAAGTAATGCGG - Intergenic
937626294 2:124047599-124047621 CCAGAGCAACAGAATTAATGAGG - Intronic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
938586139 2:132692301-132692323 CAACAACAACAAAATTAACTGGG - Intronic
938966128 2:136390155-136390177 CAAAAAGAACAGAAGAAATGAGG - Intergenic
939276199 2:139999888-139999910 GAAGAACAACAAAAGTAATTTGG - Intergenic
939505910 2:143047054-143047076 CAACAACAAAAAAGATAATGTGG - Exonic
940253953 2:151709460-151709482 GAACAACAACAAAAGTACTTTGG - Intronic
940305897 2:152226131-152226153 ACACAACAACAAAAATAATGCGG - Intergenic
940664593 2:156592863-156592885 CAACAACAACAATAATAATGGGG - Intronic
941636087 2:167936217-167936239 CCAGAAAAACAGAACTAATGGGG - Intergenic
941891964 2:170592015-170592037 CAACTTCAACAGAATTATTGTGG - Intronic
942027883 2:171928501-171928523 CAACAACAACAAAAAAAATGGGG - Intronic
942032613 2:171977952-171977974 CAACATCAACAGAAAAACTGTGG + Intronic
942174241 2:173316072-173316094 CAACAATAACAAAAATAATGAGG - Intergenic
944186335 2:196953062-196953084 CAACAACAACAAAAATAGTCAGG + Intergenic
944291548 2:198012624-198012646 AGACAACAAGAGAAGAAATGAGG - Intronic
945369955 2:209004314-209004336 AGACAACAACAGAAGTCAAGGGG + Intergenic
947686464 2:232090088-232090110 CAACAACAACAAAAATTATCTGG - Intronic
1169876744 20:10306137-10306159 CAACAAAACCAGAATTGATGAGG + Exonic
1170330677 20:15207401-15207423 AACAAACAAAAGAAGTAATGGGG - Intronic
1170586081 20:17735152-17735174 CAACAATTGCAGAAGTAGTGGGG + Intronic
1171772740 20:29337903-29337925 CAACAACAACAAATGGAAAGAGG - Intergenic
1172211227 20:33199873-33199895 AAACAACAACAGGAAGAATGTGG + Intergenic
1172220388 20:33270415-33270437 CAACAACAACAAAATTAACTGGG - Intergenic
1172223043 20:33286734-33286756 CCACAACATCAGAAGTGCTGAGG - Intronic
1172241297 20:33414283-33414305 AAACAACAACAAAACTAAAGAGG + Intronic
1172284302 20:33730464-33730486 CAACAACAACAAAAGTAGCTGGG - Intergenic
1173712284 20:45169892-45169914 CAACAAAAAAAGAAACAATGGGG + Intergenic
1173740633 20:45398648-45398670 CAATAACAACAGTAAAAATGAGG - Intronic
1174079564 20:47961399-47961421 CAACAACAAAACAAGGAATGGGG + Intergenic
1175360668 20:58409244-58409266 AAACAAGAAAAGAAATAATGTGG + Intronic
1175548321 20:59796038-59796060 AAACAACAACAGAGGAAAAGAGG - Intronic
1177087096 21:16719179-16719201 CAACAACAAAAAAATCAATGGGG + Intergenic
1177226271 21:18260861-18260883 CAACAACAACAAAAGAACTTTGG + Intronic
1177251088 21:18591988-18592010 CAACAGCAATTTAAGTAATGTGG - Intergenic
1177655627 21:24012783-24012805 CAACAATAAAATAAGTAATTAGG + Intergenic
1177826307 21:26087810-26087832 AAACAACAGCCTAAGTAATGTGG - Intronic
1178474182 21:32922017-32922039 CCACAACAAGTGAAGAAATGAGG + Intergenic
1178564872 21:33674443-33674465 CAACAGCACCAGCATTAATGGGG - Intronic
1178825768 21:36015506-36015528 CAACAACAACAAAAGGAAGGTGG - Intergenic
1179409077 21:41148275-41148297 CAACAACAACAAAAAAGATGTGG - Intergenic
1179412114 21:41169718-41169740 AAACAACTACAGAAGTTATTCGG - Intronic
1179669719 21:42938120-42938142 CAACAACAACAAAATTAGTCGGG - Intergenic
1180318116 22:11295698-11295720 CAACAACAACAAATGAAAAGAGG - Intergenic
1180647722 22:17353307-17353329 CAACAACAACAAAAATATTCTGG - Intergenic
1181183642 22:21085546-21085568 CAACAACAACAAAAGAAAAAAGG + Intergenic
1182495620 22:30705271-30705293 CAACAACAACAAAAATACTGGGG - Intronic
1184484521 22:44768293-44768315 AAACAACAAAAAAAGAAATGAGG - Intronic
949265105 3:2147988-2148010 CAACATCAATAGAAGTAGTGTGG - Intronic
949730683 3:7109139-7109161 CAACTAAAACAAAAGGAATGAGG - Intronic
949810636 3:8002976-8002998 CAACAACAACAAATAAAATGTGG - Intergenic
950261894 3:11548400-11548422 CAACAACAAAATAAGTAAACTGG - Intronic
951307642 3:21085178-21085200 AAACAATAACAGAACTAGTGAGG - Intergenic
951864326 3:27290773-27290795 CAACAACAACAAAAGGAACAGGG + Intronic
952489658 3:33855864-33855886 CAACAACAACAAATGTAAGGAGG + Intronic
954239437 3:49282042-49282064 CAACAACAACAAAAGAAAATGGG + Intronic
955337411 3:58098318-58098340 CAACAACAAAACAAGTAAACAGG - Intronic
955995149 3:64672686-64672708 CAACAACAACAAAGGTTTTGGGG + Intronic
956073274 3:65477518-65477540 CAATAACAACAGAAGAAACAAGG + Intronic
956109588 3:65857033-65857055 CAGCTCCAACAGAGGTAATGGGG + Intronic
957065913 3:75522027-75522049 CAACAAACACTGATGTAATGAGG - Intergenic
958095007 3:88933309-88933331 TAACAAAAACACAAGTAATTTGG - Intergenic
958260328 3:91373130-91373152 CAGCAACTACAGAAGCAATAAGG + Intergenic
958421329 3:93934858-93934880 TAACAACAACAGAAGTGAAACGG + Intronic
958739270 3:98048955-98048977 CAACAAAAAGAGAAAAAATGTGG - Intergenic
959135814 3:102418323-102418345 CAACAACTACAGGAGTTTTGCGG - Intronic
960061651 3:113329238-113329260 CAAGGACAGCATAAGTAATGTGG + Intronic
960251076 3:115454233-115454255 CAACAACAACAAAAGAAACCTGG + Intergenic
961160084 3:124716540-124716562 CAACAACAACAAAAAAAAGGTGG + Intronic
963251228 3:143105186-143105208 AGACAACAACAGAAGTCAAGGGG + Intergenic
963430519 3:145196338-145196360 CAACAACAACAAAAATGAGGAGG + Intergenic
963516210 3:146312138-146312160 CAACAACAACAAAAACTATGGGG - Intergenic
964562474 3:158012870-158012892 CAACAACAACAACAACAATGAGG + Intergenic
965289065 3:166853474-166853496 CAACAAAAACAAAAATAAAGTGG - Intergenic
965512458 3:169583365-169583387 CAACCCCAACAGATGCAATGCGG - Intronic
966632180 3:182089036-182089058 AAACAAAAAAAGAATTAATGAGG + Intergenic
966676996 3:182600374-182600396 CAACAACAACAAAAAAAAAGAGG + Intergenic
967206877 3:187131557-187131579 CAACAACAACAAAAGAACTGTGG + Intronic
967948407 3:194822278-194822300 CAACAACAACAACAGTTCTGGGG + Intergenic
968020405 3:195382254-195382276 TAACAACAACAAAAGTATTTTGG + Intronic
968020785 3:195386863-195386885 GAAGAACAAAAGCAGTAATGAGG + Intronic
968200848 3:196753699-196753721 CAACATCAACAGAATTTCTGAGG - Intronic
969197615 4:5575762-5575784 CAACAACAACAAAAAGACTGGGG + Intronic
971276952 4:25207603-25207625 CAACAAGAACAGAAGCAATAGGG + Intronic
972314220 4:37910844-37910866 CAACAACATCAGGATAAATGGGG - Intronic
972565908 4:40268774-40268796 CAACAACAACAAAATTAAAATGG + Intergenic
973210872 4:47614180-47614202 CAACAACAAAAAAAGAAATTGGG - Intronic
974386931 4:61213108-61213130 CAACAACAACAGAAGTAATGGGG + Intronic
974495502 4:62621501-62621523 CAAGAACCACAGAATCAATGGGG - Intergenic
974496913 4:62641826-62641848 TAACAACAATAGAAGTAAACTGG - Intergenic
974874165 4:67682611-67682633 CAACAACAACAAAAAAAATTTGG + Intronic
975813204 4:78190898-78190920 AAACAACAAAAGATGTAATTAGG + Intronic
976206238 4:82625912-82625934 CAACAACAACAACAGAAATCCGG + Intergenic
976916625 4:90384082-90384104 CAACAACAACAAAAAAAACGAGG - Intronic
976953076 4:90857727-90857749 GAAGAACAACAGGAGAAATGGGG + Intronic
977520512 4:98077215-98077237 CAACAACAACAAAACTATTGAGG - Intronic
977707747 4:100090189-100090211 CAACAACAACAAAAATAAAAGGG - Intergenic
978157204 4:105502848-105502870 CAACAACAAAAGAAATATTGAGG + Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
978321471 4:107500561-107500583 CAAAGACAAAAGAAGTTATGTGG + Intergenic
978542327 4:109831420-109831442 CAAAAACCACAGAAATCATGAGG + Intronic
979199827 4:117964114-117964136 AAACAACAAAAGAAAAAATGAGG + Intergenic
979305300 4:119135448-119135470 CAAGAAGAAAGGAAGTAATGTGG - Intergenic
980114846 4:128669501-128669523 CAACAACAACAAAAATAAGCGGG - Intergenic
980338121 4:131501674-131501696 CAACAACAACAAAAATTACGAGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981231616 4:142362996-142363018 TAACAGCAACAAAAATAATGTGG + Intronic
981847859 4:149189879-149189901 CAACAACAACAAAAAAAAGGGGG + Intergenic
982463130 4:155695971-155695993 CAACAAAAACAAAAGTACTGGGG + Intronic
982716779 4:158817172-158817194 CAACAACATCAGAAGGCAAGGGG + Intronic
983443392 4:167816795-167816817 CCAAAACAACTGAAGTTATGGGG - Intergenic
983844797 4:172504626-172504648 AAAAAAAAAAAGAAGTAATGGGG + Intronic
984489762 4:180418175-180418197 CAACAACAACAAAAATTATCTGG - Intergenic
984540155 4:181028011-181028033 AACCAATAACAGAAGTCATGAGG - Intergenic
985321307 4:188714652-188714674 CATCAAAAACAGATGTATTGTGG - Intergenic
986062671 5:4206493-4206515 CAGCAACAACAGATTTAAAGAGG - Intergenic
986883804 5:12208811-12208833 AAACAACAACATAGGGAATGTGG + Intergenic
987845124 5:23274042-23274064 CATCAACAACTGATGTAATTTGG - Intergenic
988096977 5:26627707-26627729 CAACAACAACAAAATCAATAAGG - Intergenic
988248502 5:28722271-28722293 CAGCAACAACTGGAGTGATGTGG + Intergenic
988476029 5:31586710-31586732 CAACAACAACAAAACTGTTGGGG + Intergenic
988779990 5:34511927-34511949 AAAAAAGAACAGAAATAATGTGG - Intergenic
988962689 5:36385455-36385477 CAAGAAAAACAGAAGTAACAAGG - Intergenic
990105363 5:52251791-52251813 CAACACCAAAAGAAATGATGAGG + Intergenic
990478529 5:56185232-56185254 CAACAACAACAAAAGAACTGTGG + Intronic
991604148 5:68383539-68383561 CAACAACAACAGAACTTGTGGGG + Intergenic
992118006 5:73561157-73561179 CAACAAACACAGAGGAAATGAGG - Exonic
992567855 5:78019149-78019171 CAACAACCATAGAAGTAAAATGG + Intronic
992983530 5:82202924-82202946 GAAAGACAAAAGAAGTAATGGGG + Intronic
993113341 5:83686964-83686986 CAACAATAACAGAAGTTAATAGG + Intronic
994634257 5:102324430-102324452 CAACAACAACAAAAACACTGGGG - Intergenic
994726037 5:103436836-103436858 TAACAACCACAGGAGTCATGAGG - Intergenic
995407641 5:111818653-111818675 CAACACCAACTGAAGAACTGTGG + Intronic
996246148 5:121265664-121265686 CCAAAACAACAGAAGTAAAATGG + Intergenic
996616501 5:125447846-125447868 CAACAACAACAGAAATACAGGGG - Intergenic
997098713 5:130943673-130943695 CAAAAACAACAGAAGAAGGGGGG + Intergenic
998280885 5:140806616-140806638 CAACAACACCAGAAATACTAGGG + Intronic
998641454 5:144016107-144016129 CAACAACAACAACAGAAAGGTGG + Intergenic
999954252 5:156683261-156683283 CAACAAAAGCAGAAGTAAATGGG - Intronic
1000575360 5:162969468-162969490 CAACAACAACAAAAATTATCTGG + Intergenic
1001045625 5:168369375-168369397 CAACAACAACAAAACAAATAAGG - Intronic
1002074820 5:176702003-176702025 CAACAACAACAAAAGTGACCTGG - Intergenic
1002156920 5:177289805-177289827 CAACAACAACAAAAAAAATAAGG - Intronic
1003990928 6:11485751-11485773 CAACAACAACAACAGTATAGCGG + Intergenic
1004049933 6:12066972-12066994 CAACAATAATAATAGTAATGTGG + Intronic
1005318217 6:24625108-24625130 TAAAAAAAACAGAAGTTATGGGG - Intronic
1005437956 6:25835601-25835623 CAACAACAAAAATAGTAAGGAGG + Intronic
1005662732 6:28015808-28015830 CAACAACAACAAAAATTATTGGG + Intergenic
1005678284 6:28179232-28179254 CAACAACAACAAAAAAAATTAGG + Intergenic
1005769779 6:29056211-29056233 CAACAACAACAGAAAAGCTGAGG - Intergenic
1006110855 6:31744315-31744337 CAACCCCAACCAAAGTAATGTGG + Intronic
1007680474 6:43629813-43629835 CAACAATAACAGCCGTAATTTGG - Intronic
1007772973 6:44206008-44206030 CAACAACAACAACAAAAATGAGG - Intergenic
1008146459 6:47897479-47897501 CAACAGCAACTGAATTTATGAGG + Intronic
1008652106 6:53574171-53574193 CTGCAACAACAGCAGTAATGTGG - Intronic
1008994903 6:57647259-57647281 CAGCAACTACAGAAGTAATAAGG - Intergenic
1009183438 6:60546025-60546047 CAGCAACTACAGAAGTAATAAGG - Intergenic
1010169665 6:72960394-72960416 CAACAACAACAAATGTATTTGGG - Intronic
1010638071 6:78284480-78284502 AAACTACTAAAGAAGTAATGGGG - Intergenic
1011103699 6:83755026-83755048 GTACAACAACAGAAGTACTAAGG - Intergenic
1011282086 6:85687480-85687502 CAACAAAAATAGAACTAAGGGGG + Intergenic
1012006765 6:93722278-93722300 CAAAATCAAAAGATGTAATGAGG + Intergenic
1012314968 6:97774681-97774703 CACCAACAACTGAAGTATTAGGG + Intergenic
1012801579 6:103836224-103836246 CAACAACAACACAGGGCATGAGG - Intergenic
1012932843 6:105334726-105334748 CAACAACAACAACAGAGATGCGG + Intronic
1013223387 6:108100259-108100281 CAAGAAAATCAGATGTAATGTGG + Intronic
1013395391 6:109732261-109732283 CAACAACAACAAGCGCAATGTGG - Intronic
1013540464 6:111103207-111103229 CAACAACAACAAAATTAAATGGG - Intronic
1014237181 6:118971246-118971268 CAACAAAAACAAAAGTTATTTGG + Intronic
1014386193 6:120805328-120805350 CAAGAACAATGTAAGTAATGCGG - Intergenic
1014498838 6:122161613-122161635 CTACAATAGCAGAAGTAAAGAGG + Intergenic
1014899078 6:126941404-126941426 CCACAACAACAGGAGTTCTGTGG - Intergenic
1015016895 6:128424538-128424560 GAAGAACAGCAGAAGTCATGAGG + Intronic
1015941080 6:138452841-138452863 CAACAACAACAGAAAAAGTGGGG + Intronic
1016127703 6:140426517-140426539 CAACAACAAAAGAAACACTGGGG - Intergenic
1016301222 6:142633831-142633853 CAACAACAACAAAAAAAAAGAGG + Intergenic
1016776843 6:147913706-147913728 CAACAACAAAAAATGAAATGGGG + Intergenic
1016934323 6:149437758-149437780 CAACAACAACAAAAATAAATGGG - Intergenic
1018860390 6:167707010-167707032 CAACAACAAAGGAAGAAAAGAGG + Intergenic
1019044209 6:169130770-169130792 CAACAACAACAAAAAAAATATGG - Intergenic
1020716480 7:11680077-11680099 CAAAAAAAAAAAAAGTAATGGGG + Intronic
1021092975 7:16504522-16504544 CAAAAACAAGGGAAGTTATGGGG + Intronic
1021338150 7:19429777-19429799 CAACAACAACAAAAATTAAGGGG - Intergenic
1021511767 7:21440878-21440900 CAACAACAACAGCAGCAAACAGG + Intronic
1021769006 7:23979761-23979783 CATCAACAGCAGAATTAATCAGG - Intergenic
1022582480 7:31569732-31569754 CAACAACAAAAAAAGTAGAGGGG - Intronic
1023038183 7:36151375-36151397 CTAGAACAACAGAAATAATCTGG - Intergenic
1023570795 7:41569358-41569380 CAACAACAGCAGGAGTCATCAGG - Intergenic
1024149025 7:46550093-46550115 CAACAACATGAGCAGTAAGGTGG - Intergenic
1024398959 7:48901723-48901745 CAACAACAACAAAAGTGGAGAGG - Intergenic
1024908526 7:54418576-54418598 CAGCAACAACAAAAGTCTTGGGG + Intergenic
1026901849 7:74041698-74041720 CAAGAACAACAAAAGAGATGAGG - Intronic
1027169312 7:75859586-75859608 CAACAACAAAAAAAGAAATGTGG + Intronic
1027652122 7:80880934-80880956 AAACAAAAACAGAAGTAAATCGG + Intronic
1028008724 7:85613410-85613432 CAATAACAAATGCAGTAATGTGG + Intergenic
1028508961 7:91601014-91601036 CAACAACAACAAAAAAAATAGGG - Intergenic
1028751960 7:94392891-94392913 CAACAACAACAAAAGACCTGAGG - Intergenic
1029003248 7:97178851-97178873 CAACAACAACAAAAATAAACTGG - Intronic
1030333189 7:108295101-108295123 CAAAATCAACAGATTTAATGAGG - Intronic
1030849016 7:114459561-114459583 CAACAACAACAAAACTACTGTGG - Intronic
1030914233 7:115292728-115292750 CAAAAAAAACAGAATTAAAGTGG - Intergenic
1030976727 7:116133722-116133744 CAAGAACATGAGAAGTAAAGAGG - Intronic
1030992898 7:116322704-116322726 CAACAACATCATAAGGAATGTGG + Intronic
1031545003 7:123040648-123040670 AAACGACAGAAGAAGTAATGGGG + Intergenic
1031819720 7:126485349-126485371 CAACAACAACAAAAAAAAAGGGG + Intronic
1031995010 7:128224586-128224608 GAATGACAACACAAGTAATGAGG + Intergenic
1032161978 7:129517856-129517878 CATCAACAACAGATAAAATGGGG + Intergenic
1032982240 7:137297633-137297655 CAACAACAAAACAGGCAATGAGG + Intronic
1033683395 7:143618621-143618643 CAACAACAACGAAAATAAGGTGG - Intergenic
1033701218 7:143839017-143839039 CAACAACAACGAAAATAAGGTGG + Intergenic
1034553631 7:151836495-151836517 CAACAACAACAAAGGCAAGGTGG + Intronic
1035201173 7:157267434-157267456 CAACAACAACAAAGCAAATGTGG + Intronic
1035860058 8:3018911-3018933 CAACAACAACAAAAGTTAATGGG - Intronic
1038427826 8:27476111-27476133 CAACAACAACAAAATGAATGAGG - Intronic
1038428814 8:27483519-27483541 CAACAACAACAAAATGAATTGGG - Intergenic
1038868184 8:31462765-31462787 CAACAAAAACAAAAATAAAGTGG - Intergenic
1039203678 8:35124918-35124940 CAACAAAAACAGGAGTAAATTGG + Intergenic
1039224729 8:35376239-35376261 CAACAGCAACAGGAGAAAAGAGG + Intronic
1039305405 8:36256595-36256617 TAACAACAAAAGAAACAATGAGG - Intergenic
1039506177 8:38054160-38054182 CAACAACAACAAAAAAAGTGTGG + Intronic
1039891222 8:41686847-41686869 CAATAACAATAAAAATAATGGGG - Intronic
1040518040 8:48150417-48150439 GAATAATAACAGATGTAATGTGG - Intergenic
1040830919 8:51676118-51676140 CAACAACAATCTAAGTAATAAGG - Intronic
1041568947 8:59313809-59313831 CAACAACAACAGCAGCAATATGG - Intergenic
1042139714 8:65665650-65665672 CAACAACAACAAACATAAAGTGG - Intronic
1042515672 8:69656286-69656308 CGACAACAACAAAAATAAAGTGG - Intronic
1043225929 8:77730019-77730041 CAACAAAAAAAGAAATAATCAGG + Intergenic
1043820106 8:84852908-84852930 CAACAACAACAAAAACCATGGGG + Intronic
1044058202 8:87599120-87599142 CAACAACAACAAAAATAAGCAGG + Intronic
1044215807 8:89608929-89608951 CAACAACAACAAAAGCCATTTGG + Intergenic
1044361230 8:91286534-91286556 CAACAACAACAAAAGTATCAAGG - Intronic
1044420835 8:91994003-91994025 CAACAACAACAAAAAAACTGAGG + Intronic
1044463240 8:92472178-92472200 TAACTACAACATAAGTAACGAGG + Intergenic
1044994297 8:97824003-97824025 TAACAACAATAAAAATAATGGGG - Intronic
1045531558 8:102989792-102989814 CAACAACAACAGAGGCAAATAGG - Intergenic
1045751653 8:105491542-105491564 CAACAACAACAAAAAAGATGAGG - Intronic
1045961903 8:107978405-107978427 CAACAAAAAAAGAAGAAATGGGG + Intronic
1047388082 8:124427960-124427982 CAACAACAACAAAAATAAACAGG + Intergenic
1048610954 8:136022646-136022668 CAACAACAACAAAAATAATCTGG + Intergenic
1049270245 8:141691768-141691790 CAACAACAACAAAAAAAGTGGGG - Intergenic
1049667962 8:143856460-143856482 CAAGAACAACAGGAAGAATGTGG + Intergenic
1050869350 9:10547133-10547155 CAATATCAACAGAAGAATTGGGG + Intronic
1051963134 9:22792637-22792659 GAACAAGAAGAGAAGTAATGAGG + Intergenic
1052378574 9:27744819-27744841 CAACAACAACAAAAATAAAGAGG + Intergenic
1053132843 9:35627994-35628016 CAACAACAACAAAATTAGTCTGG - Intronic
1055644798 9:78353015-78353037 CAACAACAACAAAAATAACCTGG - Intergenic
1055872891 9:80905442-80905464 CAACAACAACAAAAATTATAAGG + Intergenic
1056344066 9:85672384-85672406 CAACCACAACAAAAGTGATGTGG - Intronic
1057426102 9:94951003-94951025 CCACAACCACAGAGGCAATGTGG - Intronic
1057694419 9:97313208-97313230 GAGCAACAACAGAGGTGATGAGG - Intronic
1058188273 9:101881800-101881822 CAACAACAACAAAAAAAGTGTGG - Intergenic
1060486172 9:124048178-124048200 CAGCAACACCAGAAGAAACGTGG - Intergenic
1060490861 9:124083241-124083263 CAACAACAACAAAAAAAAAGTGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060852250 9:126887613-126887635 CAACAACAACAAAAAAAATTAGG - Intergenic
1061848975 9:133403586-133403608 TAACGACAACAGCAGAAATGGGG - Intronic
1062450206 9:136612052-136612074 CCACAAAAACAGAAGAAATTCGG + Intergenic
1187039904 X:15582756-15582778 CAAAAAAAACAGAAAGAATGAGG + Intronic
1187622300 X:21071102-21071124 CAACAACAACAAAAGAAACAGGG - Intergenic
1187788658 X:22922812-22922834 CAACAATAACAGTAGTAACCTGG + Intergenic
1188116980 X:26256516-26256538 CAACAGCAACAAAACTAGTGAGG + Intergenic
1188997508 X:36904188-36904210 CAACAACAACAGAAAAAATGTGG + Intergenic
1189956912 X:46285226-46285248 AAACAACAACAAAAATAAAGTGG - Intergenic
1191051291 X:56195197-56195219 CAACAGCAACAGAACAAATCTGG + Intergenic
1191883717 X:65867331-65867353 CAACAACAACAAAATTAACTGGG + Intergenic
1191931544 X:66379103-66379125 CAACAACAAAACCAGAAATGGGG - Intergenic
1193538560 X:82742759-82742781 CAACAACAACTGAGGTAGAGAGG - Intergenic
1193579345 X:83244651-83244673 CAACAACAACAAAAGTTAGCTGG - Intergenic
1193827889 X:86248931-86248953 CAACAACAAAAAAAGCAATGGGG + Intronic
1194787502 X:98105531-98105553 CAAGAACCACAGCATTAATGAGG - Intergenic
1194792098 X:98163002-98163024 AAACAAAAACTGAAATAATGTGG + Intergenic
1196038169 X:111170103-111170125 CAACTAAAGCAGTAGTAATGAGG + Intronic
1196699068 X:118646344-118646366 CAACAACAACAAAAAAAATCAGG + Intronic
1198581386 X:138068636-138068658 CAATAACAGCAGAAAGAATGGGG - Intergenic
1201522542 Y:14891972-14891994 AAACAAAAATAGATGTAATGTGG - Intergenic
1202117705 Y:21487751-21487773 GATCAACAACAGTAGTAAAGTGG - Intergenic