ID: 974388812

View in Genome Browser
Species Human (GRCh38)
Location 4:61237496-61237518
Sequence GATTCACTCATGGAGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974388812 Original CRISPR GATTCACTCATGGAGCTGTC AGG (reversed) Intronic
906922597 1:50080580-50080602 GATTTTCTGATGGAGATGTCAGG - Intronic
909546083 1:76848587-76848609 AATTCACTCATGAAGCCATCTGG + Intergenic
910291917 1:85607598-85607620 GTTTCACAGATGGAGCTGGCAGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
917356218 1:174129504-174129526 GATTCTGTCATGATGCTGTCTGG + Intergenic
918055646 1:181019489-181019511 GATTCACCCACGCAGCTTTCTGG - Intronic
922546470 1:226461213-226461235 GACTCTCCCTTGGAGCTGTCTGG + Intergenic
922886481 1:229024673-229024695 GATGCCCTCATGGTGCTGCCTGG + Intergenic
1067077596 10:43197061-43197083 CATGAACTCATGGATCTGTCTGG + Exonic
1068203469 10:53815001-53815023 GGTTGACTCATGGATCTGACTGG - Intronic
1068906231 10:62326313-62326335 GATTTAATCTTGGATCTGTCTGG - Intergenic
1069220247 10:65874352-65874374 GATTCCGTCATGGTTCTGTCTGG - Intergenic
1070730844 10:78827206-78827228 CATCCACTCATGGACCTGCCTGG + Intergenic
1075777631 10:124998569-124998591 GTCTCCCTCATGGAGCTGGCAGG + Intronic
1076371235 10:129956193-129956215 GCTTAACTCATGGAGTTTTCCGG + Intronic
1077448666 11:2619798-2619820 TATTCAGTCATGAAGCTATCTGG + Intronic
1079682441 11:23315470-23315492 GACTCTCTGATGGAGCTTTCTGG + Intergenic
1079746696 11:24141008-24141030 ATTTCTCTCATGGATCTGTCTGG - Intergenic
1080674725 11:34414860-34414882 GATCCACTCATTCAGCTGTCAGG + Intergenic
1080990939 11:37533883-37533905 GATTCTCTTATGGTTCTGTCGGG - Intergenic
1081221406 11:40467910-40467932 TATTGACTGATGGAGCTGTTGGG + Intronic
1084658121 11:70531280-70531302 GAGGCACTCATGGGGCTGGCAGG - Intronic
1085358501 11:75863164-75863186 GATGGACTCAAGGAACTGTCTGG - Intronic
1086886248 11:92209265-92209287 GATTCTTTCCTAGAGCTGTCAGG - Intergenic
1089620593 11:119720092-119720114 GATTCACCCAAGGAGCAGTGTGG + Intronic
1091170470 11:133515888-133515910 GACTCACTCATGGCGCTGTGAGG - Intronic
1091777258 12:3192590-3192612 CAGTCCCTCCTGGAGCTGTCTGG + Intronic
1093729527 12:22551460-22551482 AATTCTCTTATGCAGCTGTCTGG - Intergenic
1094189372 12:27681772-27681794 GCTTCACTCATGGCCCTTTCTGG - Intronic
1096010603 12:48210956-48210978 GAATAACTCTTGGAGCTATCAGG - Intergenic
1097831429 12:64228488-64228510 AATTCACCCATGAAGCTATCTGG + Intergenic
1100828839 12:98499603-98499625 GATGTAGTCATGCAGCTGTCTGG - Intronic
1104169478 12:126266192-126266214 GATTCACTCATTAACCTGCCTGG + Intergenic
1105309916 13:19197428-19197450 AATTCACTAATGAAACTGTCTGG + Intergenic
1105527563 13:21190013-21190035 AATTCACTAATGAAACTGTCTGG - Intergenic
1109987375 13:70006668-70006690 GTTTCTCTCATGGACATGTCGGG + Intronic
1114362014 14:21984250-21984272 AACTCACTAATGAAGCTGTCAGG + Intergenic
1116358991 14:43969015-43969037 AATTGAAACATGGAGCTGTCAGG + Intergenic
1117677236 14:58167171-58167193 GAATCACTCAGGGTGCTGTGAGG - Intronic
1118981077 14:70717629-70717651 GCCTCACTCATTGACCTGTCTGG + Intergenic
1120884829 14:89443679-89443701 GAGTCCCTCATGGGACTGTCAGG + Intronic
1120888872 14:89473694-89473716 CATTCACTCTTGTAGATGTCAGG + Intronic
1122169848 14:99863390-99863412 GGTTCACTCTTGGTGCTGTAAGG + Intronic
1127346004 15:58099310-58099332 AATTCACTAATGAAGCTATCTGG + Intronic
1132975881 16:2711016-2711038 GAGTCCCTCCTGGAGCTGGCAGG + Intergenic
1133146133 16:3788046-3788068 GCTACACTCATGGAGATGCCGGG + Intronic
1134220040 16:12346613-12346635 GAGGCACTCATGCAGCTGTGAGG - Intronic
1137637809 16:50002339-50002361 GATCCCCTCAGGGAGCTTTCAGG + Intergenic
1141284277 16:82656610-82656632 GGTTCACTCTTGGTGCTGTACGG + Intronic
1153321530 18:3778685-3778707 GCTTCACAAATGGAGTTGTCTGG - Intronic
1156539419 18:37894798-37894820 GATGCTCTTCTGGAGCTGTCTGG + Intergenic
1160497754 18:79385083-79385105 GCTTCACTCATCGAGATGCCAGG - Intergenic
1161591560 19:5131453-5131475 GTTTCCCCCATGGAGCTGACGGG + Exonic
1161727367 19:5937529-5937551 AATGGACTCATGGAGCTGACTGG + Intronic
925535406 2:4911224-4911246 GATTCATGCATGGAGCCTTCTGG + Intergenic
926959173 2:18335267-18335289 GATTCATTCATGGGACTATCTGG + Intronic
929387429 2:41426243-41426265 AATTCACTCATACAGCTGTCAGG - Intergenic
930916931 2:56703532-56703554 GATTGACTCATTCACCTGTCTGG - Intergenic
932705364 2:74020530-74020552 TATTCCTTGATGGAGCTGTCTGG + Intronic
937129113 2:119494068-119494090 ACCTCACTCATGGAGCTGGCAGG + Intronic
939458218 2:142465233-142465255 GATTCACTTAGAGAGCTGTGTGG - Intergenic
940583054 2:155605625-155605647 TATTGACTCGTGGAGCTGACTGG - Intergenic
946042281 2:216792560-216792582 CATGCACTAATGGAACTGTCTGG - Intergenic
947898908 2:233703050-233703072 AATTCACTAGTGAAGCTGTCTGG + Intronic
948523147 2:238554309-238554331 GACTCACTGCTGGAGCTGCCAGG - Intergenic
1170388116 20:15842274-15842296 TATACACTGATGGAGCTGTTGGG + Intronic
1170421520 20:16198207-16198229 AATTTAGTCATGGAGCTGGCTGG - Intergenic
1173467365 20:43294167-43294189 TATTGACACATTGAGCTGTCTGG + Intergenic
1173860486 20:46280060-46280082 GAGTCACACCTGGGGCTGTCTGG + Intronic
1174076913 20:47943892-47943914 GACTCACCCATGGAACAGTCAGG + Intergenic
1174200763 20:48804931-48804953 AATGCCCTCATGGAGATGTCGGG + Intronic
1176720562 21:10389450-10389472 AATGCAGTCAGGGAGCTGTCTGG + Intergenic
1177084504 21:16686371-16686393 TAGTCAGTAATGGAGCTGTCGGG - Intergenic
1178874596 21:36403931-36403953 GAATCACACATGCAGCTGTGTGG + Intronic
1179063626 21:38003833-38003855 GCTTAACTCATGGAGCTGTCTGG + Intronic
1180301766 22:11042296-11042318 AATGCAGTCAGGGAGCTGTCTGG + Intergenic
1184275101 22:43405509-43405531 GAGCCACCCATGGACCTGTCTGG + Intergenic
949950845 3:9227552-9227574 GATTCAGTCCTAGATCTGTCTGG + Intronic
950646933 3:14382880-14382902 CCTGCACTTATGGAGCTGTCCGG + Intergenic
950655408 3:14433322-14433344 GCTTCACCCATGGAGCCGGCAGG + Intronic
952007033 3:28853726-28853748 AATTAATTAATGGAGCTGTCTGG - Intergenic
953501628 3:43441546-43441568 AATTCACCCATGAAGCTCTCTGG - Intronic
960860976 3:122153604-122153626 GACTAACACAGGGAGCTGTCTGG + Intergenic
963603582 3:147396596-147396618 GGTTCACTGCTGGCGCTGTCTGG - Intronic
965902071 3:173653976-173653998 GACTCACTCATGTGGCTATCCGG - Intronic
967476290 3:189924248-189924270 AATTCACTCATGAAGCCATCTGG - Intergenic
968041456 3:195592595-195592617 GATTCACACCTGGATCTGTCTGG + Intergenic
968089839 3:195893078-195893100 GACTCCCTCATGGACCTGTGTGG + Intronic
974388812 4:61237496-61237518 GATTCACTCATGGAGCTGTCAGG - Intronic
975099322 4:70494382-70494404 GATTCATTCTGGGAGCTGTAAGG + Intergenic
981545100 4:145885677-145885699 GATTTTCTCATGAAGCTGTCAGG - Exonic
986044002 5:4020304-4020326 GGCTCACTCTTGGAGCTGCCCGG + Intergenic
988525506 5:31983489-31983511 GATTCTCTCAAGGAGGTGGCTGG + Exonic
992094538 5:73349609-73349631 GATTCACCCTTGAAGCTCTCTGG - Intergenic
993441713 5:87964536-87964558 GAAGCAGTCATGGAGCTGACTGG - Intergenic
994983885 5:106910776-106910798 GATTCACTCAGCGTGCTGTGTGG - Intergenic
994998886 5:107102227-107102249 CACTCAGTCATGGAGGTGTCTGG + Intergenic
1002063116 5:176638161-176638183 GATACCCAGATGGAGCTGTCGGG + Intronic
1002069997 5:176673585-176673607 GGGTCACTCCTGGAGCTGTCCGG + Intergenic
1005088953 6:22036263-22036285 GATTATCTCAAGGAGCTGGCAGG + Intergenic
1005490741 6:26344858-26344880 GCTACACACATGGAGCTGTTTGG + Intergenic
1007721634 6:43888668-43888690 GAGTCACTCCTGGTGCGGTCAGG - Intergenic
1011530012 6:88311712-88311734 GAATCAGTCATGGAGCGGTGAGG + Intergenic
1013737716 6:113247448-113247470 GGTTCACTCATGTGGCTGGCAGG + Intergenic
1015181574 6:130366446-130366468 GTCTCACTCCAGGAGCTGTCGGG - Intronic
1017334968 6:153245693-153245715 GATTCAATCATGGATGTGACTGG - Intergenic
1018238569 6:161750444-161750466 TATTCACTTATGGATTTGTCAGG - Intronic
1018838808 6:167504665-167504687 GCTTCTCTCATGGAGATGTTGGG + Intergenic
1023156795 7:37259318-37259340 GATTCGTTCATGGAGCTGCTGGG + Exonic
1029643353 7:101835303-101835325 CATTGACTCATGCACCTGTCTGG + Intronic
1029711872 7:102304184-102304206 GATGCACCCTTGGAGCAGTCAGG + Intronic
1030693257 7:112556697-112556719 GTTGCACACATGGAGCAGTCTGG - Intergenic
1035446156 7:158944647-158944669 GGTGCACTCAGGTAGCTGTCAGG + Intronic
1035529484 8:339430-339452 GATCCAATCATGAAGCTGGCAGG - Intergenic
1035837926 8:2775500-2775522 GAATCACCCGTGGAGCCGTCTGG + Intergenic
1038872644 8:31512441-31512463 GATCCTCTCATGGAGTTGTTAGG + Intergenic
1038889301 8:31700776-31700798 AATCTACTCATGGATCTGTCAGG + Intronic
1040972876 8:53156387-53156409 GGTTCACTGCTGGATCTGTCTGG - Intergenic
1041730053 8:61053767-61053789 CATTCCGTCCTGGAGCTGTCAGG + Intergenic
1043481624 8:80658420-80658442 GATCCACTGATGTAGGTGTCAGG - Intronic
1043989534 8:86735534-86735556 GATTCTCTCCTGGAGCTTCCAGG - Intronic
1046168946 8:110479381-110479403 AATTCACTAATGAAGCCGTCTGG + Intergenic
1049575920 8:143389509-143389531 GAGTGACTTATCGAGCTGTCAGG + Intergenic
1050809092 9:9720571-9720593 GATTCACGTATGGAGGTGGCAGG - Intronic
1058879928 9:109277469-109277491 GATCCAGACATGGACCTGTCGGG + Intronic
1060204341 9:121673880-121673902 GAGTCACCCATGGAGCTGATGGG - Intronic
1188973310 X:36643064-36643086 TATTTGCTCATGGAGCTCTCAGG + Intergenic
1195080195 X:101363287-101363309 CATTCCCTCATGGAGTTGTGAGG + Intronic
1195313760 X:103658061-103658083 GATCCTCAGATGGAGCTGTCTGG + Intergenic
1195649473 X:107270093-107270115 AATTCACTCTTGAAGCTGTCTGG - Intergenic
1196914449 X:120517799-120517821 AATTCACTAGTGAAGCTGTCTGG - Intergenic
1197674465 X:129314542-129314564 GATTCACTTATTATGCTGTCAGG - Intergenic