ID: 974389624

View in Genome Browser
Species Human (GRCh38)
Location 4:61249429-61249451
Sequence CAGGAGGAGGAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13586
Summary {0: 7, 1: 321, 2: 1261, 3: 3333, 4: 8664}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974389624_974389634 26 Left 974389624 4:61249429-61249451 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 974389634 4:61249478-61249500 GGATCACCTCACATTAAAGATGG 0: 1
1: 0
2: 0
3: 4
4: 96
974389624_974389633 5 Left 974389624 4:61249429-61249451 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 974389633 4:61249457-61249479 TGACTCTGGCGTTCATTCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 100
974389624_974389630 -9 Left 974389624 4:61249429-61249451 CCCTCCTCCTCCTCCTCCTCCTG 0: 7
1: 321
2: 1261
3: 3333
4: 8664
Right 974389630 4:61249443-61249465 CTCCTCCTGCATTTTGACTCTGG 0: 1
1: 0
2: 2
3: 20
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974389624 Original CRISPR CAGGAGGAGGAGGAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr