ID: 974389971

View in Genome Browser
Species Human (GRCh38)
Location 4:61253555-61253577
Sequence CAGGGAATATACTGTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974389964_974389971 24 Left 974389964 4:61253508-61253530 CCAAAGACTTACACCAAGAGGAA 0: 1
1: 0
2: 1
3: 9
4: 179
Right 974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 126
974389965_974389971 11 Left 974389965 4:61253521-61253543 CCAAGAGGAATTGTTGTCTGATT 0: 1
1: 0
2: 1
3: 16
4: 195
Right 974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG 0: 1
1: 0
2: 1
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974389971 Original CRISPR CAGGGAATATACTGTGTTGC AGG Intronic
903417830 1:23196476-23196498 GAGGGAAAATACTGCATTGCAGG - Intergenic
909818174 1:80024197-80024219 CATGGCATGTACTGTGTTCCAGG + Intergenic
911452675 1:98084823-98084845 CACAGAAAATACTGTTTTGCTGG + Intergenic
916442279 1:164839259-164839281 CAAGGAGTTTACTGTTTTGCAGG - Intronic
919041770 1:192398118-192398140 CATGGAATATGTTGTGTTGTAGG + Intergenic
920227503 1:204449237-204449259 CTGGGATTTTCCTGTGTTGCTGG + Exonic
921666731 1:217881685-217881707 CAGAGAAGTCACTGTGTTGCTGG + Intergenic
922004558 1:221516603-221516625 CATGGCATATACTGTGTAGTGGG + Intergenic
922395214 1:225192417-225192439 CAGTTTATATACTGTGTTCCTGG + Intronic
922939943 1:229454256-229454278 CAGGGAATGTGCTGAGTTGCAGG + Intronic
1064183540 10:13140746-13140768 CAGGGAATATGCAGGGCTGCAGG - Intergenic
1064270990 10:13865888-13865910 CAGGGAAGACACTGTGGGGCGGG + Intronic
1064297599 10:14092435-14092457 CTGGGAATGGACTCTGTTGCTGG + Intronic
1064308706 10:14191733-14191755 CAGGGAATATATTCTGAGGCTGG - Intronic
1070194664 10:74146118-74146140 CAGGAAATATAGTGTGCTGTGGG + Intronic
1071586176 10:86823752-86823774 CAGGGAGGATACTTTGTGGCTGG - Intronic
1073727009 10:106244433-106244455 CAGGGAATTTACCATGTAGCAGG - Intergenic
1074116308 10:110459770-110459792 CAGGGAATGCACAGGGTTGCCGG + Intergenic
1078954324 11:16173047-16173069 TATGGAATTTACTGTGTTCCAGG + Intronic
1085530957 11:77191714-77191736 CAGGGGAGGTACCGTGTTGCTGG + Intronic
1092671691 12:10868660-10868682 CAGGGAGTTTCCTGTGGTGCTGG - Intronic
1093314893 12:17637138-17637160 CAGGGAATAGAATGGGTTGCAGG - Intergenic
1093658732 12:21728039-21728061 CAGGGATTATTCTGTGTGTCTGG + Intronic
1094519853 12:31175020-31175042 CAGAGCAGATACAGTGTTGCAGG + Intergenic
1094761778 12:33541392-33541414 CAGGGAATAAAATGTGAGGCAGG + Intergenic
1097577105 12:61408610-61408632 AAGGCAATGTACTGTGTTGCTGG + Intergenic
1099660462 12:85552012-85552034 CAGTAAATATACAGTGATGCAGG + Intergenic
1101008408 12:100425406-100425428 CAAGGCATGTACTGTGTGGCTGG - Intergenic
1102940402 12:116936527-116936549 GAGAGAAGATGCTGTGTTGCTGG + Intronic
1106044856 13:26129447-26129469 CAAGAAATATACTGTGTTTTAGG - Intergenic
1110795836 13:79637030-79637052 CATAGAATATAGTGTCTTGCTGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113362260 13:109642475-109642497 CAGGGAATATACTCTGTTCCTGG - Intergenic
1118469209 14:66059072-66059094 CAGTGAATATATTTTCTTGCAGG + Intergenic
1124809682 15:32923023-32923045 AAGTGAATATACTGGCTTGCTGG + Intronic
1126461755 15:48922203-48922225 CATGGAATTTACACTGTTGCTGG - Intronic
1126950417 15:53874230-53874252 CAGGGAATTTACTCTGCTCCAGG + Intergenic
1127789155 15:62383057-62383079 CATGGAATATACTTAGTGGCAGG - Intergenic
1129917527 15:79287219-79287241 CAGGCAATATGCTGTGGAGCTGG - Intergenic
1130160733 15:81397479-81397501 CAGGGACCATCCTGTGTTTCTGG + Intergenic
1135436128 16:22427877-22427899 AAGGGTATCTGCTGTGTTGCTGG - Intronic
1138490855 16:57375704-57375726 CAGGAAATGTCCTGGGTTGCTGG - Intronic
1139629193 16:68217891-68217913 CAGGAAATATACTCTGTAGCTGG + Intronic
1139870593 16:70105611-70105633 CAGGGAATATTCTGTGTTTTGGG - Intergenic
1141163791 16:81647069-81647091 CTGGGAATCTTGTGTGTTGCTGG - Intronic
1142045341 16:87921708-87921730 AAGGGCATCTGCTGTGTTGCTGG - Intronic
1142772836 17:2111962-2111984 CAGGGAAGATACTGTATTTGTGG - Intronic
1150323439 17:64236027-64236049 TAGGGAAAAATCTGTGTTGCAGG - Intronic
1150484212 17:65532797-65532819 CTGGGAATAGACTGTGGTCCTGG + Intronic
1164281206 19:23770261-23770283 CAGGGATTGTGATGTGTTGCTGG + Intronic
1164311772 19:24052146-24052168 CAGGGATTGTGATGTGTTGCTGG + Intronic
927604611 2:24475361-24475383 CAGGGGATGTTCTGGGTTGCTGG + Intergenic
931644725 2:64411536-64411558 TAAGGAATAGATTGTGTTGCAGG - Intergenic
933585279 2:84173479-84173501 CAGGGGATACACTTTTTTGCAGG - Intergenic
936069495 2:109356191-109356213 CTGGGAAAATACTGGGGTGCAGG - Intronic
937147264 2:119658392-119658414 TCTGGAATATACTGTGATGCTGG - Intronic
938416459 2:131106777-131106799 CAGGAATCAAACTGTGTTGCAGG + Intronic
940470520 2:154092834-154092856 CAGGGAATATTGTGGGGTGCAGG + Intronic
942905752 2:181178971-181178993 CAGGGAAGGTACTGTGTTGAAGG - Intergenic
944827006 2:203494321-203494343 CAGTGAATATAATGTATTACTGG + Intronic
944943869 2:204660437-204660459 CAGGGAATATGCTAAGTTGCGGG + Intronic
948031448 2:234821058-234821080 TTTGGAATATACTGTGTTGAAGG - Intergenic
1174243655 20:49159077-49159099 CAGGGATTGTACTGCGTTGCAGG - Intronic
1176994981 21:15544504-15544526 AAGGGAATCTACTGCCTTGCAGG + Intergenic
1178075126 21:29008535-29008557 CAGGGAACATACTGGCTAGCAGG + Exonic
949147084 3:714762-714784 CAGGGAATATACTGGGTGGGTGG - Intergenic
952076981 3:29708889-29708911 AAGGGAATTTTCTGAGTTGCAGG + Intronic
952505012 3:33999452-33999474 CAGGCAATATACACTGTGGCAGG + Intergenic
952862640 3:37826800-37826822 GTGGGAATATACACTGTTGCTGG - Intergenic
955522504 3:59788483-59788505 CAGGGAAGAAAATGTGTTCCAGG - Intronic
956585670 3:70861895-70861917 GAATGAATATACTTTGTTGCTGG - Intergenic
958027164 3:88061480-88061502 CAGGTAATAAACTATGTTTCAGG - Intronic
958615950 3:96493840-96493862 CAGGGAGGATACTGTGGTGGGGG + Intergenic
959733749 3:109633672-109633694 CTGGGAATATTGTGTGATGCTGG + Intergenic
962074976 3:132072051-132072073 CAGGGCTTATTCTGTTTTGCTGG - Intronic
962932364 3:140050116-140050138 CTGAGAATATACTGTGTGCCAGG - Intronic
964663701 3:159150023-159150045 CAGGGAAAATAGGGTGTTGGTGG - Intronic
965610374 3:170537290-170537312 GAGAGAAGATACTATGTTGCTGG - Intronic
966336092 3:178869971-178869993 CAGGGAAGAGACAGTGTAGCTGG - Intergenic
969009400 4:4049152-4049174 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
969744956 4:9063172-9063194 CAGGCACTGTGCTGTGTTGCGGG + Intergenic
970538342 4:17052816-17052838 CAAGGAAGATTCTGTGGTGCAGG - Intergenic
972075925 4:35087103-35087125 GATAGAATATATTGTGTTGCTGG - Intergenic
974370189 4:61006657-61006679 CAGGCAACATCATGTGTTGCTGG - Intergenic
974389971 4:61253555-61253577 CAGGGAATATACTGTGTTGCAGG + Intronic
976825234 4:89253474-89253496 CAGGAGATATTCTGTGTTCCTGG - Intronic
977460272 4:97316682-97316704 CAGGGAAAATACTGTCTTCAAGG + Intronic
978240638 4:106512132-106512154 AAGGGAATATTGTGTGATGCTGG + Intergenic
978356222 4:107877793-107877815 CAGAGAATAAGCTGTGTTGAAGG - Intronic
979573867 4:122263235-122263257 CAGGGGAAATTCTATGTTGCTGG - Intronic
982282625 4:153700759-153700781 CATTTAATATAGTGTGTTGCTGG + Intergenic
982468305 4:155758609-155758631 AAAGGAATATCCTCTGTTGCTGG - Intergenic
982816736 4:159895145-159895167 CAGTGCATATAGTGTGTTACAGG + Intergenic
983992628 4:174139748-174139770 CAGGGAATATATTTTGGTGGAGG - Intergenic
985194074 4:187408571-187408593 CAGGGAATATCCTGGTCTGCCGG + Intergenic
987656485 5:20814631-20814653 GAGGGAATCTACTGGTTTGCAGG - Intergenic
988767072 5:34389314-34389336 AAGGGAATCTACTGGTTTGCAGG + Intergenic
993736232 5:91479647-91479669 CAGGGAATATAAGGTGATGATGG + Intergenic
995056272 5:107762627-107762649 GAGAGGATATACTGTGTTGCAGG + Intergenic
998923701 5:147099371-147099393 CTGGGAATTTACTATGTAGCAGG - Intergenic
999078959 5:148825853-148825875 AAGGGAATACACTGGGTTACCGG + Exonic
1001542700 5:172550553-172550575 CAGGGGCTCTACTGTGTTGTCGG - Intergenic
1001767459 5:174262129-174262151 AAGGGAATCCACTGTGTTGCAGG - Intergenic
1003164633 6:3665571-3665593 CTGGGAAGATGCTGAGTTGCAGG - Intergenic
1004079171 6:12374074-12374096 CAGGGAATTTACTCAGTTCCAGG + Intergenic
1004124037 6:12854914-12854936 AAGGGAATATACGTTGTTGGTGG + Intronic
1010006174 6:70997987-70998009 CAGGGAATCTCCTGGTTTGCAGG - Intergenic
1014361380 6:120480012-120480034 CTGGGAATATTCTATGTGGCTGG - Intergenic
1016672119 6:146721285-146721307 CAGGAAACTTACTGTGTTGTAGG - Intronic
1017248420 6:152253093-152253115 CAGGGACAAGACTGAGTTGCTGG + Intronic
1018391953 6:163347390-163347412 CAGGGAATATATAGAGTTGGGGG + Intergenic
1024352200 7:48377899-48377921 CAGAGAGTAGACTTTGTTGCTGG - Intronic
1027856243 7:83515220-83515242 CAGGGAAGTTCCTGTGCTGCAGG + Intronic
1028705221 7:93835468-93835490 CAGCTAATATACTGTGTTAACGG - Intronic
1029068357 7:97874675-97874697 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1031421240 7:121553775-121553797 CTGGGAATGTATTTTGTTGCAGG + Intergenic
1034780816 7:153880758-153880780 CAGGTAATAGACTGTATTTCAGG - Intergenic
1036250682 8:7159827-7159849 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1036366807 8:8127627-8127649 CAGGCACTGTGCTGTGTTGCGGG + Intergenic
1036884073 8:12538034-12538056 CAGGCACTGTGCTGTGTTGCGGG - Intergenic
1037366608 8:18128985-18129007 AAGGGAATCTGCTGTCTTGCTGG + Intergenic
1037842780 8:22257049-22257071 TTGGGAATATACTGTTTTGAGGG - Intergenic
1041726142 8:61019253-61019275 CAAGGAGTATGCTGTGTTCCTGG + Intergenic
1049126879 8:140797893-140797915 CAGGGATTCTCCTGTGTAGCTGG + Intronic
1049318919 8:141985545-141985567 CAGGGGATACACTATGATGCAGG - Intergenic
1049966239 9:782706-782728 AAGGGAACATACAGTGTTGATGG + Intergenic
1051572308 9:18573228-18573250 CAAGGAATATACTGAGTAGATGG - Intronic
1055689716 9:78816459-78816481 CAGGGGATAGAGTGTGTTCCTGG + Intergenic
1057503838 9:95616709-95616731 CTGAGCATATACTGTGTGGCAGG + Intergenic
1058012613 9:99994965-99994987 GAGGAAGTATACTGTGTTGATGG - Intronic
1059795587 9:117693098-117693120 CAGGGAGCATACTGTGCTACGGG - Intergenic
1189474160 X:41335820-41335842 CTGGGAATACTCTGTGCTGCTGG - Intronic
1193289346 X:79753474-79753496 AAGAGAATATACTGTCTTGAAGG - Intergenic
1193429086 X:81378060-81378082 CAGGGAAGCTACTGTCTTCCAGG + Intergenic
1194347936 X:92788434-92788456 GAGGAAATATACTGTGTTCAAGG - Intergenic
1195234788 X:102886546-102886568 TGGGGAATATACTGTGTTCATGG - Intergenic
1198764867 X:140070228-140070250 CAGGGACTCTACTGTCTTTCAGG + Intergenic
1200656262 Y:5905056-5905078 GAGGAAATATACTGTGTTCAAGG - Intergenic
1201992594 Y:20043541-20043563 CAGGGAATATCCTGGTTTGTGGG + Intergenic