ID: 974390182

View in Genome Browser
Species Human (GRCh38)
Location 4:61257198-61257220
Sequence CAGTGATAGACTTGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974390182 Original CRISPR CAGTGATAGACTTGGGAATA TGG (reversed) Intronic
901498301 1:9635530-9635552 CAGTGATTTCCCTGGGAATATGG - Intergenic
903175293 1:21576687-21576709 CGGGGATGGGCTTGGGAATAGGG + Intronic
905215591 1:36405168-36405190 CAGTGTAAGACATGGGAAAATGG - Intergenic
906822319 1:48942572-48942594 AAGTGGAAGACTTAGGAATATGG - Intronic
911792279 1:102032513-102032535 CATTGGTAGACTTGTCAATATGG - Intergenic
911957057 1:104250651-104250673 CAGTGATAGATGTTAGAATAAGG - Intergenic
912158663 1:106953719-106953741 TTGTGATAGCCTTGGGGATACGG - Intergenic
912543658 1:110435487-110435509 CAGTGCTAGTGCTGGGAATATGG + Intergenic
915682399 1:157594275-157594297 TAGGGATGGACTAGGGAATAGGG + Intronic
915850682 1:159318875-159318897 CAGTGATAGTCTATGGAAGAAGG - Intergenic
916388751 1:164306947-164306969 CAGTGGTAGAATTGGGGCTAGGG - Intergenic
916705898 1:167349854-167349876 CAGTCATAGTCTTGTGTATATGG + Intronic
916845020 1:168641880-168641902 TAGTGATGGACTTGAGAATTTGG + Intergenic
919391692 1:196993135-196993157 TAGTGATAGAGTTGAGTATAAGG + Intronic
919849227 1:201661318-201661340 CAGTGAGAGGCTTGGGAGGAAGG - Intronic
920381130 1:205535095-205535117 CAGTGATAGAGGTGGGGAGATGG - Intergenic
920768049 1:208852348-208852370 CTGTGTTAGACTTGGCAATAGGG - Intergenic
922871057 1:228902324-228902346 GAGTGACAGAGTTGGGAAAAGGG + Intergenic
923294327 1:232579026-232579048 CAGTGATAGACCAGGGAACAGGG - Intergenic
924219488 1:241858049-241858071 CAGTGATAAATGAGGGAATAGGG + Intronic
1063080543 10:2763310-2763332 CAGTGAGTGACCTGGGAATCTGG + Intergenic
1064386034 10:14892520-14892542 CAGTGATTGAGTAGGGAACATGG - Intronic
1065086540 10:22184367-22184389 CAGTGTTAGAAGTGGCAATAAGG + Intergenic
1067485396 10:46644689-46644711 CAGTGGTAGACAGGAGAATAAGG + Intergenic
1067609362 10:47696975-47696997 CAGTGGTAGACAGGAGAATAAGG - Intergenic
1070013658 10:72502605-72502627 CAGGGAGTGGCTTGGGAATAGGG - Intronic
1071156644 10:82697383-82697405 CAGAGATCACCTTGGGAATATGG - Intronic
1071230045 10:83575784-83575806 CAGTAATTCACTTGGGATTATGG + Intergenic
1071529976 10:86381875-86381897 CAGGGATTGTCTGGGGAATATGG + Intergenic
1071624954 10:87158620-87158642 CAGTGGTAGACAGGAGAATAAGG - Intronic
1073169579 10:101492804-101492826 CAGTGATAGTTTTGTGGATATGG + Intronic
1075440600 10:122476724-122476746 CAGTGAGAGACTGGGTAGTAAGG + Intronic
1078400881 11:11025898-11025920 CAGTGGTAGGCTTAGGAATTAGG + Intergenic
1080203993 11:29707813-29707835 CAGTGATAGGTTTAGGGATAGGG - Intergenic
1080453516 11:32398147-32398169 CATTGAAAGGCTTGGGAGTAGGG + Intronic
1082882989 11:58056835-58056857 CAGTGAGAGGCTTGGGGATGGGG - Intronic
1084176959 11:67427945-67427967 CAGTGATAGACCTGTAAATATGG - Intergenic
1084258969 11:67961980-67962002 CAGTGATTTTATTGGGAATATGG - Intergenic
1089163944 11:116460451-116460473 CAGTGATAGATCTGGGAAAGAGG + Intergenic
1089208299 11:116783111-116783133 CAGTGATAGACTGCGGACAAGGG + Intronic
1092275133 12:7055106-7055128 CAGAAATAGAATTCGGAATATGG - Intronic
1092430289 12:8402987-8403009 CAGTGATGTTATTGGGAATATGG - Intergenic
1094528986 12:31254446-31254468 AAGTGAAAGACTTGGGAAAAGGG - Intergenic
1096760088 12:53834321-53834343 GAGTGGTAGAGTTGGGAGTAGGG + Intergenic
1098145286 12:67490840-67490862 CAGAAATAGAATTTGGAATATGG + Intergenic
1098301351 12:69057184-69057206 CAGAATTTGACTTGGGAATATGG - Intergenic
1099040866 12:77653245-77653267 CAGTGATAGAAAGGGGAACAGGG - Intergenic
1100849066 12:98690474-98690496 CAGTGAAAGACTTCAGAAGAAGG + Intronic
1104189003 12:126459751-126459773 CAGTGAATGCCTGGGGAATAAGG - Intergenic
1107007449 13:35630308-35630330 CAGTGAAAGAATTGTGTATAAGG + Intronic
1108697331 13:52913974-52913996 CAGTGCTAGACCTGGCAACATGG - Intergenic
1109208526 13:59508476-59508498 CAGTGAAAGATTTGGGGAAACGG - Intergenic
1111120429 13:83841852-83841874 CAGGGAGTGACTTTGGAATAGGG - Intergenic
1112543571 13:100342052-100342074 GAGTCATAAACCTGGGAATATGG + Intronic
1113119717 13:106913416-106913438 CATTGATAGATTTGAGAAAATGG - Intergenic
1113130149 13:107027483-107027505 AAGTGATTGACTTTGGAATTGGG - Intergenic
1114398371 14:22387322-22387344 CAGTTTTAGAGTTGGGAATGCGG + Intergenic
1115945714 14:38657936-38657958 CAGTGATAGCCTTGGGGTTTAGG - Intergenic
1116258568 14:42589830-42589852 AAGTGATAGAATTAGGAGTAGGG - Intergenic
1117065217 14:52006736-52006758 CAGTGATAGAATGGGGAAATAGG + Exonic
1119813915 14:77547964-77547986 CAGTAATAGACTTGTTAATTAGG - Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1124459145 15:29872917-29872939 CAGAGATACGCATGGGAATAGGG + Intronic
1131755754 15:95559439-95559461 AAGTGTTAGGCTTGGGCATAAGG + Intergenic
1132510773 16:340306-340328 CAGTGATGCACTTGTGGATAGGG - Intronic
1133365896 16:5209885-5209907 CAGTGATTTTATTGGGAATATGG + Intergenic
1135043195 16:19133689-19133711 CACAGATAGAGTTTGGAATAAGG - Intronic
1135184147 16:20300334-20300356 CAGTGATAGGCTTGGCAAACAGG + Intergenic
1135533570 16:23275312-23275334 CTGTGCCAGACTTGGGAAGATGG + Intergenic
1135882559 16:26272676-26272698 CAGTGATTACCTAGGGAATAGGG + Intergenic
1137362244 16:47829278-47829300 CAGTGAAAGACTTAGGACTGAGG + Intergenic
1139548084 16:67659069-67659091 CAGTGATAGGCCTGGGGACAGGG + Exonic
1140653752 16:77118092-77118114 CACTGCTAGACTGGGGAAAATGG - Intergenic
1141133998 16:81453899-81453921 CAGGGGAAGACTTGGGAACATGG + Intronic
1143548105 17:7612012-7612034 CAGTGATAGACTTGAATAGATGG - Intronic
1145984519 17:29036322-29036344 CAGAGAAAGACCTGGAAATAAGG + Intronic
1147222902 17:38949882-38949904 CAGTGATAGACTGGGCAAGGTGG - Intronic
1155453047 18:25982920-25982942 CAACTACAGACTTGGGAATAGGG - Intergenic
1157691284 18:49684057-49684079 CAGGGAAAGACGTGGGAATCTGG + Intergenic
1163067583 19:14810317-14810339 CAGTGTTAGACTTAGACATATGG + Intronic
1163265123 19:16216141-16216163 CAGAAATAGACTTCAGAATATGG - Intronic
1165321604 19:35088842-35088864 CTGTGCTGGAATTGGGAATATGG - Intergenic
1165613946 19:37182298-37182320 GAGTGATACACTTAGGAGTAAGG + Exonic
1167456756 19:49600310-49600332 CAGAGAAAGACTTGGGGATGGGG + Intronic
1167831781 19:52028816-52028838 AAGTGTTAGATTTGGGGATAGGG + Intronic
925161340 2:1686149-1686171 CAGTGAGAGACTTGGGCAAAGGG - Intronic
932438948 2:71719690-71719712 TAGTGCTAGCCTTGGGAACATGG - Intergenic
933491862 2:82994995-82995017 CAGTGATTGATTTAGGCATAGGG - Intergenic
935703521 2:105836042-105836064 CAGTGAGATACATGGGAACATGG - Intronic
937656406 2:124381734-124381756 CAGGGTTAGACATGTGAATATGG + Intronic
940513595 2:154650781-154650803 TAATGAAAGACTGGGGAATATGG - Intergenic
941269241 2:163404735-163404757 CAGTGATTGAATGGGGAAGAAGG - Intergenic
942162505 2:173206480-173206502 CAGTGAGAGAGTTGGAAATGTGG - Intronic
945208683 2:207359352-207359374 GAGTGGTAGATTTGGGAATCAGG - Intergenic
945883504 2:215350868-215350890 AAGTTAAAGACTTGGGAAGAGGG - Intergenic
1173106737 20:40144145-40144167 CAGGGATAGATTTGGGAATTTGG - Intergenic
1175067078 20:56298213-56298235 GAGTTATAGACTTTGGAATCTGG - Intergenic
1178150302 21:29786480-29786502 CAGTAATAGAATTTAGAATAGGG - Intronic
949614296 3:5736989-5737011 GAGAGAAAGACTTTGGAATAAGG + Intergenic
949957519 3:9281169-9281191 CAGTGATAGCATTAAGAATATGG + Intronic
952082289 3:29773942-29773964 CAGTAAGGGACTTGGGAATTGGG - Intronic
952805431 3:37345423-37345445 CAGTTATACACTTTGGAATTTGG + Intronic
957073918 3:75586500-75586522 CAGTGATTTTATTGGGAATATGG - Intergenic
959239546 3:103771902-103771924 TAGTGATAGCCAGGGGAATATGG + Intergenic
960375886 3:116900866-116900888 CCTAGATAGACTTGGGAATGGGG + Intronic
961280167 3:125760220-125760242 CAGTGATTTCATTGGGAATATGG + Intergenic
961874237 3:130009352-130009374 CAGTGATTTCATTGGGAATATGG - Intergenic
962235249 3:133701510-133701532 CTGTGTTAGACGTGGGCATATGG + Intergenic
965666786 3:171102670-171102692 CAGTGAGAGACAGGGGATTAGGG + Intronic
966289049 3:178333800-178333822 CAGATATAGACTTCAGAATATGG - Intergenic
966470468 3:180283289-180283311 CAGAGATAGAGATGGGAATGGGG - Intergenic
966511854 3:180773060-180773082 CAGTGATAAGCATGGGAACAGGG + Intronic
967116179 3:186341129-186341151 CTGTGAAGGACTTGGGAATAGGG + Intronic
967570055 3:191017813-191017835 AAGTAAGTGACTTGGGAATATGG + Intergenic
968023857 3:195420976-195420998 TAGTGATAGAATAAGGAATAGGG + Intronic
968788839 4:2645286-2645308 CACTGATAGACTTAGGTATTAGG + Intronic
969017501 4:4113810-4113832 CAGTGATTTTATTGGGAATATGG - Intergenic
969038723 4:4276965-4276987 CAGAAATAGACTTAGGAAGAAGG + Intronic
969736442 4:8994495-8994517 CAGTGATGTTATTGGGAATATGG + Intergenic
969795634 4:9526058-9526080 CAGTGATGTTATTGGGAATATGG + Intergenic
971725088 4:30301656-30301678 CATTGAGAGACTTGAGAATTAGG + Intergenic
972945066 4:44243965-44243987 CAGTAATGGACTTCGGAAGATGG + Intronic
974390182 4:61257198-61257220 CAGTGATAGACTTGGGAATATGG - Intronic
975897021 4:79105785-79105807 CAGAAATAGAATTTGGAATATGG - Intergenic
977282063 4:95052472-95052494 GAGTTATAGAGTTGGAAATAAGG + Intronic
977366474 4:96075284-96075306 AAGTTAAAGATTTGGGAATAAGG - Intergenic
977846686 4:101775431-101775453 TTATGATAGACCTGGGAATAAGG + Intronic
978303421 4:107295148-107295170 CAGTCACGGACTTGGGAAGACGG - Intergenic
978467652 4:109026540-109026562 TGGTTATAGACTTGGGAAAAGGG + Intronic
980684712 4:136211916-136211938 CTGGGATAGATTTGGGCATATGG - Intergenic
981416850 4:144503748-144503770 CAGTGATTGATTTGGGACTTGGG + Intergenic
981751201 4:148093709-148093731 CAGAAATAGCCTTGTGAATATGG + Intronic
982796557 4:159653242-159653264 AAGTGACAGGGTTGGGAATATGG - Intergenic
983283276 4:165707969-165707991 GATTGATAGACCTGGGAATACGG + Intergenic
984250897 4:177333279-177333301 CAGTGATAGCTTGGAGAATACGG + Intronic
989949182 5:50276771-50276793 CTGTGATAAACATAGGAATATGG - Intergenic
989964290 5:50450502-50450524 CAGTGATAGCCTTGGCATAATGG + Intergenic
991174294 5:63668497-63668519 CAGACATAGACTTCAGAATATGG + Intergenic
991297866 5:65100912-65100934 CAGCGCTAGACATGGGCATACGG + Intergenic
991578083 5:68125655-68125677 CAGTGTTAGTCTTCTGAATATGG - Intergenic
994738944 5:103594388-103594410 CAGTGAAAGAGTTTGGAATATGG - Intergenic
995621458 5:114030513-114030535 AAGTGATACACTTGGCAAGATGG - Intergenic
996749009 5:126870704-126870726 CATTGACAGACTTTGGAATGAGG + Exonic
997146120 5:131435063-131435085 CAGAGAAAGACTTGGAACTAAGG - Intronic
997898268 5:137739759-137739781 CAGTGTTAGAGTTGGAGATAGGG + Intergenic
998355398 5:141531258-141531280 TAGTGATTGACTTGGGATAAAGG - Intronic
998893054 5:146767371-146767393 CAGTGACAGTCTTAGGAATATGG - Intronic
999482277 5:151959662-151959684 CTGGGATACACTTGGAAATATGG + Intergenic
1000654065 5:163854702-163854724 CAATGATAGACTGGATAATATGG + Intergenic
1000655315 5:163871375-163871397 CATTGCTAAACTTGTGAATATGG + Intergenic
1000952412 5:167500612-167500634 CAGTGATAGAGATGAAAATAAGG - Intronic
1003465896 6:6379645-6379667 CAGTCATAAACTTGGGATTATGG + Intergenic
1003567933 6:7236259-7236281 CAGTGATGGGCTTGGGACTATGG + Intronic
1004077566 6:12358365-12358387 CAGGGACAGACTGGGGAAGAAGG - Intergenic
1004806535 6:19209710-19209732 CAGAAATAGAATTGAGAATATGG - Intergenic
1006295748 6:33169318-33169340 GAATGACAGACCTGGGAATATGG - Intronic
1006654846 6:35582138-35582160 AAGTGAGTGACTTGGGAAGAAGG - Intronic
1009808396 6:68631451-68631473 AAGGGATAGACTTGGGGTTAAGG - Intergenic
1009998298 6:70921576-70921598 CAGAGATAGAATTGAGAATCTGG - Intronic
1011245186 6:85314812-85314834 CCGTGACAGACTTGGAAAAATGG - Intergenic
1012226999 6:96716212-96716234 CAGTGGTACTCTGGGGAATAGGG + Intergenic
1013740924 6:113283696-113283718 CAGTGATAGACTGGAAAATGTGG + Intergenic
1023620084 7:42062237-42062259 CAATGACAGACAGGGGAATATGG - Intronic
1026571741 7:71537342-71537364 CAGTCACAGGCTTGGGAATCAGG - Intronic
1027434896 7:78154407-78154429 CAGTGATGCACTTGCGGATAGGG + Intronic
1028329710 7:89575139-89575161 CAGAAATAGAATTTGGAATATGG - Intergenic
1028707541 7:93867805-93867827 GACTGAGAGACTTGAGAATAAGG - Intronic
1031182781 7:118437803-118437825 CAGAGATAGAATTCAGAATATGG + Intergenic
1032224628 7:130021423-130021445 AAGTGATAGGCTGGGTAATATGG - Intronic
1033650098 7:143335180-143335202 CAGACATATACTTGGGAATCTGG - Intronic
1035743516 8:1945801-1945823 CAGGGACAGACGTGGGAGTACGG + Intronic
1036065473 8:5376373-5376395 CAGTGATAGAATGCGGAAGAAGG - Intergenic
1036357148 8:8053091-8053113 CAGTGATTTTATTGGGAATATGG + Intergenic
1036901422 8:12672163-12672185 CAGTGATTTTATTGGGAATATGG - Intergenic
1038087587 8:24216940-24216962 CATTTATAAACTTGGGAGTATGG + Intergenic
1039683524 8:39769669-39769691 CACTCACAGACTTGGGAATTTGG - Intronic
1042106239 8:65329410-65329432 CACTGAAATATTTGGGAATAAGG + Intergenic
1045496226 8:102711535-102711557 CAGTGGTAGTCTTTGAAATATGG - Intergenic
1045699348 8:104849017-104849039 CAGAGATAGAATTCAGAATAGGG - Intronic
1047128792 8:121994456-121994478 CAGTGATGTTCTTGGCAATAGGG + Intergenic
1047790600 8:128199789-128199811 CAGTAATAGATTTTGGAATCAGG + Intergenic
1048068779 8:131000176-131000198 CAGTGGTAGGCCTGGGAATTGGG + Intronic
1048109771 8:131454750-131454772 CAGTAATAGAATTCAGAATATGG + Intergenic
1048129500 8:131678722-131678744 CAGTGTTGGACTTGGGTATGTGG - Intergenic
1048715593 8:137265226-137265248 CAGTGATAGCATAGGGAAAATGG + Intergenic
1050412220 9:5378297-5378319 CAGAGATACATCTGGGAATAGGG - Intronic
1053366796 9:37528520-37528542 CAGAGTCAGACTTTGGAATATGG - Intronic
1055510492 9:76991532-76991554 CAATGATTGACTTGGTAAGAGGG - Intergenic
1056054831 9:82810624-82810646 TAGTGATAGTATTGGGTATATGG + Intergenic
1059164819 9:112067702-112067724 CAGTGATAGACTTTGAAGGAGGG - Intronic
1185895633 X:3856158-3856180 AAGTGATAATCTTGGGAACATGG - Intergenic
1185900752 X:3894582-3894604 AAGTGATAATCTTGGGAACATGG - Intergenic
1185905868 X:3933021-3933043 AAGTGATAATCTTGGGAACATGG - Intergenic
1188229407 X:27642623-27642645 AAGAGATAGACATGGAAATATGG - Intronic
1188580794 X:31710533-31710555 AAGTGATAGAATTGGGAGAAGGG - Intronic
1190663070 X:52672868-52672890 TTGTGATAGACATGGGAAAAAGG - Intronic
1190676353 X:52785614-52785636 TTGTGATAGACATGGGAAAAAGG + Intronic
1191094516 X:56660432-56660454 CAGAAATAGAATTTGGAATATGG - Intergenic
1191703206 X:64064978-64065000 CAGAGATAGAATTTGAAATATGG + Intergenic
1192717114 X:73655678-73655700 CAATGATAGACTTGATAATGTGG - Intronic
1193598131 X:83473691-83473713 CAGACATAGAATTTGGAATATGG + Intergenic
1194320051 X:92435022-92435044 CAGACATAGAATTGAGAATATGG + Intronic
1194444838 X:93975150-93975172 CAGAAATAGACTTGAGAAGATGG - Intergenic
1197053245 X:122086422-122086444 CAGTGATAGACTTTGGCATGTGG - Intergenic
1197913508 X:131511575-131511597 CAGAAATAGAATTGAGAATATGG - Intergenic
1200628169 Y:5548155-5548177 CAGACATAGAATTGAGAATATGG + Intronic
1201790867 Y:17839355-17839377 TAGTGATAGTGTTGGGCATATGG + Intergenic
1201810687 Y:18066634-18066656 TAGTGATAGTGTTGGGCATATGG - Intergenic
1202352486 Y:24009009-24009031 TAGTGATAGTGTTGGGCATATGG + Intergenic
1202518293 Y:25661106-25661128 TAGTGATAGTGTTGGGCATATGG - Intergenic