ID: 974390901

View in Genome Browser
Species Human (GRCh38)
Location 4:61266214-61266236
Sequence GTCAGAAAACCTTTAGAATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974390901 Original CRISPR GTCAGAAAACCTTTAGAATA CGG (reversed) Intronic
901362323 1:8712855-8712877 GTCAGAAAAGCTTTAAAAACAGG + Intronic
901819883 1:11821670-11821692 GCCAGTAAACCTCTAGAAAAAGG + Intronic
903247653 1:22027821-22027843 GTCAGGGAACCTTTAGAGAAGGG + Intergenic
907424667 1:54372114-54372136 GTCTGGAAACCTTTAGAGTCAGG - Intronic
907792088 1:57676854-57676876 ATCAGAAAAGCTTTAGAGAAAGG - Intronic
909929685 1:81481741-81481763 GTCAGAAAACACTTTGAAAATGG + Intronic
909949020 1:81697072-81697094 GTTAGAGATACTTTAGAATATGG + Intronic
909969375 1:81961176-81961198 TTCAGAAAATCTATTGAATAAGG + Intronic
911233049 1:95380708-95380730 GTCCCAAAACCTCAAGAATAGGG + Intergenic
914963841 1:152234413-152234435 GTATGAAAATCTATAGAATATGG - Intergenic
916554496 1:165882413-165882435 GACAGAAAACCTCTAAAACAGGG + Intronic
916811499 1:168309442-168309464 GTCAGAAATACTTTAAACTATGG + Intronic
916946676 1:169735798-169735820 CTCTGAAAACCTACAGAATATGG - Intronic
917896804 1:179498634-179498656 AACAGAAAACCTCCAGAATAGGG + Intronic
918220227 1:182429975-182429997 GTCAGAAGAGCTTTAGGATGAGG + Intergenic
921095573 1:211884667-211884689 GTCAGCAACCCCTTATAATATGG - Intergenic
923395154 1:233554662-233554684 GTCAGAAATTCTTCAGAAGAGGG + Intergenic
924678020 1:246201008-246201030 GTGAGAAAACCTTGTTAATATGG - Intronic
1064260540 10:13782347-13782369 ATCAGGAGACCTTTAAAATAAGG + Intronic
1065116145 10:22485156-22485178 CTCAGAAAACCTTTATAACTAGG - Intergenic
1066312665 10:34212755-34212777 GTCAGAAAACCCTTACATTGAGG + Intronic
1066709156 10:38214807-38214829 GTGAGAAAATCAATAGAATAAGG + Intergenic
1067258229 10:44663845-44663867 CTCAGGAAACCTGTAGAATGGGG + Intergenic
1069316083 10:67104375-67104397 GAAAGATAACCTTTATAATAAGG + Intronic
1070337739 10:75470118-75470140 GTCAGAAACCCTTTTGTATTAGG + Intronic
1070417265 10:76202617-76202639 GTCAGGAGCCCTTTAGAAAAAGG + Intronic
1073875376 10:107915560-107915582 CTCACAAAACATTTAGAATATGG - Intergenic
1074861823 10:117515793-117515815 ACCAGTAAACCTTTACAATAGGG + Intergenic
1079102478 11:17550524-17550546 TTAAGAAATCCTTTAGAAAATGG + Intronic
1079416277 11:20239020-20239042 GTCAGCAAACCTTGCCAATATGG - Intergenic
1085075103 11:73584136-73584158 GTCAGAAAAAATTTAGAAAGGGG + Intronic
1085765396 11:79277568-79277590 GGCAGAAAATCTTTTGAAAATGG + Intronic
1086975590 11:93129027-93129049 GCAACAAAACCTTTAGAATAGGG - Intergenic
1087866763 11:103238605-103238627 CTCAGAAAAGCTTTAGCATTGGG - Intronic
1088391522 11:109320042-109320064 GTTAGAAAACCGTTAAACTAGGG + Intergenic
1088688793 11:112307070-112307092 GTCTGAATACCTTTTGAACAAGG + Intergenic
1091082400 11:132682904-132682926 GTGAGAAACCCTTTTGAAGAAGG - Intronic
1092025907 12:5240273-5240295 GTCAGAAAACATTTGGTAAATGG + Intergenic
1092765823 12:11851798-11851820 CTCAGGAATCCCTTAGAATAGGG + Intronic
1093157834 12:15709360-15709382 GTCAGTAAACCTTAAGGATGAGG + Intronic
1097322856 12:58245483-58245505 GTCAGAAAAACTTTCTAAGAAGG - Intergenic
1099066632 12:77988725-77988747 GTCAGAAAAGCAGTAAAATAAGG - Intronic
1100562315 12:95760195-95760217 CTCAGAAAACCTTTGTAATAGGG - Intronic
1101042132 12:100767234-100767256 GTCAGAAAACAATTACAAAATGG - Intronic
1102658660 12:114505404-114505426 GTCAGAGAAGCATTACAATAAGG + Intergenic
1105401083 13:20096772-20096794 GGCAGAAAACCTTTCTATTAAGG + Intergenic
1105626087 13:22114314-22114336 AACAGAAAACCTTTAGAAAATGG + Intergenic
1109517827 13:63467129-63467151 GTCAGAAAACATTAACAAAATGG + Intergenic
1110963124 13:81656608-81656630 GTCAGAAAACTTTTTAAATTTGG - Intergenic
1111822621 13:93231613-93231635 GCCAGAAAACGTTCAGAAAAAGG - Intronic
1114390927 14:22307908-22307930 GTCATAAAAACTTTAGAAAGTGG - Intergenic
1116910326 14:50456382-50456404 ATCAGAATACTTTTAAAATAGGG - Intronic
1117387113 14:55226691-55226713 GTTAGAAGGCCTTTAAAATAGGG + Intergenic
1117940417 14:60958559-60958581 GTCAGAAAACTTTCTAAATATGG - Intronic
1118621439 14:67618079-67618101 TTCAGAAAACATTTAGTAAAGGG + Intergenic
1120800387 14:88681939-88681961 ATGATAAAACCTTAAGAATATGG - Exonic
1122100162 14:99402137-99402159 GACTGAAGACCTTTAGCATAGGG - Intronic
1125161094 15:36644599-36644621 GTCAGCAAACATTTAGCACATGG - Intronic
1125529993 15:40406818-40406840 GCCAGGAAAGCTTGAGAATAGGG - Intronic
1125911750 15:43446123-43446145 TTCAGAAAGACTTCAGAATAGGG - Intronic
1126266378 15:46758806-46758828 GCCAGAAGACATTAAGAATAAGG - Intergenic
1133442881 16:5835658-5835680 CTCATAAAACCTTAAGAAGAAGG - Intergenic
1134511197 16:14848626-14848648 GCCAGAAATCCTTGAGATTAAGG + Intronic
1134698840 16:16247122-16247144 GCCAGAAATCCTTGAGATTAAGG + Intronic
1134972996 16:18547551-18547573 GCCAGAAATCCTTGAGATTAAGG - Intronic
1135836752 16:25832783-25832805 GTCAGCAAAATTTTAAAATATGG - Intronic
1136191621 16:28618969-28618991 GTCAGAAATCATTGAGAACATGG + Intronic
1140073561 16:71675088-71675110 ATCAGGAAACTTCTAGAATATGG + Intronic
1140870643 16:79103237-79103259 TTCAGAAAACCTTTCAAACACGG - Intronic
1143792391 17:9307929-9307951 GGCAGAAACCCTTTGGAATGAGG - Intronic
1150501750 17:65657747-65657769 CCAAGAAAACCTATAGAATAAGG + Intronic
1151058545 17:71062504-71062526 TTCAGAAACCTCTTAGAATATGG - Intergenic
1155296176 18:24386470-24386492 GTCAGAAAATCTTTAGAGTGTGG - Intronic
1156925612 18:42574549-42574571 GTGAGAAAACCTTTTGGAAAAGG + Intergenic
1158546401 18:58401320-58401342 GTCAGAATAGCTTTAAAATATGG + Intronic
1159363356 18:67433801-67433823 GTCATGAAACTTTTAAAATAGGG + Intergenic
1159706193 18:71691739-71691761 GTCCCAAAACCTTAAAAATAGGG + Intergenic
1159728212 18:71990303-71990325 GGCAGAAAACCATAAGAATGGGG + Intergenic
1159834403 18:73319884-73319906 GTCATAAAAACTTTGGAGTAAGG + Intergenic
1164675845 19:30100824-30100846 GTCTGAAAACCTTGAGAACCAGG + Intergenic
1164821029 19:31251404-31251426 GCCAGAACAGCTTTGGAATAAGG - Intergenic
1164924377 19:32117102-32117124 GTAAGAAAAACTTTAAAATGTGG + Intergenic
1166574216 19:43821931-43821953 GTCCGAAAAGCATTAGAACATGG + Intronic
1167787671 19:51648909-51648931 GCCAGAAACCCTTAAGAAAAAGG + Intergenic
925095171 2:1192809-1192831 ATCACAAAACCTCTAGAACAGGG - Intronic
925491549 2:4400696-4400718 GTCATAGAACCATTAAAATATGG - Intergenic
928422802 2:31152277-31152299 CTCAGTAAAACTTTTGAATAAGG + Intronic
929092338 2:38231609-38231631 GCCAGAAACCCTTAAGAAAAAGG + Intergenic
930469728 2:51796722-51796744 ATCAGATAACCTTAAGAAGAAGG + Intergenic
936469013 2:112781360-112781382 GTCACACGACCTTTACAATATGG + Intronic
936784630 2:116079126-116079148 GTCACAATAAGTTTAGAATAAGG - Intergenic
939309047 2:140449700-140449722 TTCAAAAAAGCTTTATAATAAGG + Intronic
939367668 2:141254881-141254903 GTCACAAAACCTTTCAAATTTGG + Intronic
939467400 2:142576715-142576737 GTCAGAAAGCCATGAGAACAAGG - Intergenic
939900140 2:147841713-147841735 GACTGAAAACCTTTGGAGTATGG - Intergenic
939914921 2:148027696-148027718 TCCACAAAACCTTTTGAATAAGG + Intronic
940695438 2:156971650-156971672 GCCAGAAAACATTTACAACATGG - Intergenic
943882760 2:193168300-193168322 GACACAAAACCTGTTGAATATGG + Intergenic
945246926 2:207727059-207727081 GTCAGAAACCCTTAACAATTGGG - Intronic
946083324 2:217146431-217146453 TTCAGATAACATTTAGAAAAGGG - Intergenic
947043893 2:225955115-225955137 GTCATAAAAGCTTTAGAATCGGG - Intergenic
1168745922 20:240158-240180 TTAGGAAATCCTTTAGAATAGGG - Intergenic
1169212751 20:3777015-3777037 GTCAGAAAACCATTAAAGTTAGG + Intergenic
1169927858 20:10801856-10801878 GTCAGAAAACCTGTGGAATGTGG - Intergenic
1170353715 20:15469829-15469851 AAAAGAAAACCTTTAGAATAGGG - Intronic
1172343729 20:34180012-34180034 GTCACAAAAGCTTGAGAAAAAGG + Intergenic
1173286763 20:41679105-41679127 GTTAGAAAACTTTTAGAATGTGG + Intergenic
1173713849 20:45184189-45184211 GGAAGAAAGCCTATAGAATAAGG - Intergenic
1174566231 20:51466365-51466387 TTCAGGAAACCCTTAGAATTAGG - Intronic
1176418451 21:6494576-6494598 TAAAGAAAACTTTTAGAATAGGG + Intergenic
1177032986 21:16005563-16005585 TTCATAAAACTTTTAGACTAAGG + Intergenic
1179252431 21:39683369-39683391 ATCAGAAAGCCTTTAGTATCTGG - Intergenic
1179693944 21:43102898-43102920 TAAAGAAAACTTTTAGAATAGGG + Intronic
951131645 3:19053379-19053401 GGCAGAAGACCATTAGAAAAGGG + Intergenic
951622440 3:24618260-24618282 GACTGAAATCTTTTAGAATAAGG - Intergenic
954907990 3:54078978-54079000 TTCAGAGAACCTTTTTAATAAGG + Intergenic
955744563 3:62127224-62127246 GTCAGAAAGCATTTATAATGTGG - Intronic
958926856 3:100167860-100167882 TTCAGAAAACATTTATGATATGG - Intronic
959238979 3:103764233-103764255 CTCAGAAAGCATTTAAAATAGGG - Intergenic
959298920 3:104574690-104574712 AACAGAAAACCTGTAGAATGAGG - Intergenic
959359600 3:105371071-105371093 GTCAGAAAAGGTTTGGAATCTGG - Intronic
959613017 3:108315932-108315954 GTCATCTAACCTTTACAATAAGG + Intronic
960454335 3:117852105-117852127 ATCAGAAAACCTTGAAAATCAGG + Intergenic
961746401 3:129066149-129066171 GTCCCAAAACCTTGAAAATAGGG - Intergenic
966951421 3:184821928-184821950 GTCAAAAATCCCTTAGTATAAGG - Intronic
967110086 3:186285424-186285446 TTCCGAATACCTTTAGAAAAAGG - Intronic
968395805 4:236461-236483 GTCAGAAAACAGTAAGAAAATGG - Intergenic
970471139 4:16380442-16380464 GTCAGGCAACCATTAGAAGATGG - Intergenic
970702740 4:18762144-18762166 CAGAGAAAGCCTTTAGAATATGG - Intergenic
971393200 4:26204935-26204957 GTCAGAAAACTGTGAGAATCTGG + Intronic
972513129 4:39788238-39788260 GTCAAAATACTTTTAGAAGATGG + Intergenic
974191850 4:58515159-58515181 TTAAGAAATCCTTTATAATAGGG - Intergenic
974390901 4:61266214-61266236 GTCAGAAAACCTTTAGAATACGG - Intronic
974662073 4:64903363-64903385 ATCAGCAAACCCTTAAAATAAGG + Intergenic
975237746 4:72020029-72020051 CTCAGAAAATATTTAAAATAGGG + Intergenic
975621508 4:76301459-76301481 GTCATTAAAACTTTAGAAAAGGG - Intronic
976773805 4:88684679-88684701 AACAGAAAACCTATAGAATGGGG + Intronic
977177733 4:93836622-93836644 GTCAGAAAGCCTTTGGTTTAAGG + Intergenic
980220877 4:129912470-129912492 TTCAGAAAACCTTTCAATTATGG - Intergenic
980881174 4:138711193-138711215 GTCAGAAAACATTTATTATCTGG - Intergenic
981640429 4:146936293-146936315 GTCAGTAGACTTTTAGTATATGG + Intronic
985289446 4:188373249-188373271 GCCACAAAACCTTTAAAATATGG - Intergenic
989440075 5:41460440-41460462 GTCAGAGAAACTTTAGAGTGAGG + Intronic
990974176 5:61543287-61543309 GTGAGAAACCTTTAAGAATAAGG - Intronic
991470685 5:66965831-66965853 GTCAGAAGATGTTTTGAATAAGG + Intronic
991483222 5:67106127-67106149 GTGAGAAAACTTGTAGAAAACGG - Intronic
993691170 5:91002584-91002606 GCCAGAAAAAATTTAGAAAATGG - Intronic
994299561 5:98131025-98131047 ATCAGATAACCTTTAGGATTTGG - Intergenic
994438914 5:99776479-99776501 GTCATAAAACTTTTATTATAAGG + Intergenic
994700691 5:103130802-103130824 TTCAGAAAAACTCTAGAAAAAGG - Intronic
995103505 5:108345475-108345497 GTAAGATAAACTTTAGAAAAGGG - Intronic
998649437 5:144101506-144101528 GTCAGCAAACCTTTTCTATAAGG + Intergenic
999003353 5:147947381-147947403 AACAGACAACCTTCAGAATAAGG - Intergenic
1000045412 5:157518199-157518221 GTCTGAAGACCTTTAGATTCTGG - Intronic
1000731148 5:164835452-164835474 TTCAAAAAACCTCTAGAATATGG + Intergenic
1000799926 5:165713249-165713271 CTCAGAAAACCTCCAGAATTAGG - Intergenic
1001060136 5:168481191-168481213 GGGAAAAAACCTCTAGAATAAGG - Intergenic
1001622460 5:173099580-173099602 GTCAGAAAACATTAACAAAATGG - Intronic
1005152932 6:22773210-22773232 GCCAAAAAGCTTTTAGAATAAGG + Intergenic
1011795843 6:90950343-90950365 GCCAGAAAACCTTCAGAGAATGG + Intergenic
1012072527 6:94640789-94640811 TTCAGAAAATCTTTAGAAGGTGG - Intergenic
1012130177 6:95481194-95481216 AACAGACAACCTATAGAATAGGG + Intergenic
1012633866 6:101510388-101510410 TTCAGAAAACCTTAAGATGATGG - Intronic
1012785587 6:103621439-103621461 AGCAGAAAACATGTAGAATAAGG - Intergenic
1013431515 6:110060655-110060677 ATCTTAAAACCTTTAGGATAAGG + Intergenic
1013973620 6:116049872-116049894 GTTAGAAAACTTTTAGGAAAAGG + Intronic
1014414034 6:121162128-121162150 GACAGACAACCTATAGAATAGGG - Intronic
1014756018 6:125302257-125302279 CTGAGAAAACCGTGAGAATATGG - Intergenic
1014803021 6:125797912-125797934 CTCTGAAAACCTTTATAACAAGG + Intronic
1015261987 6:131248354-131248376 GTGATAAAACCTTTAGAGTCAGG - Intronic
1016526347 6:145005849-145005871 GTTAGAAAACTTTTAGACAATGG + Intergenic
1016778557 6:147933429-147933451 GTCAGCAAACATTTAGAAGAGGG - Intergenic
1018841190 6:167518319-167518341 GTAACAACACCTTTTGAATAAGG - Intergenic
1020220527 7:6233114-6233136 TTCAGAGAACATTTAGAATGAGG - Intronic
1021786600 7:24158487-24158509 GGTAGAAAATCTTTAGAAAAAGG + Intergenic
1022569965 7:31442658-31442680 CTAAGAAAACCTTCAGAAAAGGG + Intergenic
1024725087 7:52184815-52184837 CTGAGAAAACCTTTAGCTTATGG + Intergenic
1026572468 7:71543421-71543443 ATCAGAAAACGTTTAGCATCTGG + Intronic
1027970674 7:85076793-85076815 GTCTTAAAATCTTTAAAATAGGG + Intronic
1028853093 7:95558599-95558621 TCCAGCAAACCTTTAAAATATGG - Intergenic
1030453299 7:109740723-109740745 TTCACAAAAACTTTATAATAAGG + Intergenic
1030965209 7:115983965-115983987 ATCAGAAAACATTTACAATTAGG + Intronic
1031368084 7:120927716-120927738 GACAGAAAAACTTCAGAGTAGGG + Intergenic
1031697055 7:124870352-124870374 GTAAGAAAGCCTTTAATATAGGG - Intronic
1032559508 7:132873967-132873989 TTCAGAAAACCTGCAGAATAAGG + Intronic
1032955695 7:136969635-136969657 GTTAGAAGGCCCTTAGAATAAGG - Intronic
1033070033 7:138193572-138193594 ATTAGGATACCTTTAGAATAAGG + Intergenic
1034384719 7:150730937-150730959 GACAGAAAACCGTAAGAATACGG + Intronic
1034650045 7:152683058-152683080 GTGAGAAAGACTTTAGCATAAGG - Intergenic
1035691782 8:1563952-1563974 GTCTGAAGACCTTTTAAATATGG + Intronic
1041377923 8:57221278-57221300 GTCAGACAACCATTAGATGACGG - Intergenic
1043158101 8:76811276-76811298 GACAGAAAACTTTTAAAATTAGG + Intronic
1043162847 8:76868265-76868287 GACAGAAAACCATTAGGATAAGG + Intergenic
1044639323 8:94361759-94361781 GTCAGAAAACCTGTAATACAGGG - Intergenic
1048298167 8:133230860-133230882 CACAGCAAACCTATAGAATATGG + Intergenic
1049071966 8:140362804-140362826 GTGAGAAAACCTTCTGGATATGG - Intronic
1051068676 9:13136094-13136116 CTCAGAAAATCTTCAAAATAAGG - Exonic
1051242483 9:15074529-15074551 GTGAGAAATCCTTTAGGATTTGG - Intergenic
1052536184 9:29750283-29750305 TTCAGACAGCCTTTAGAATGTGG + Intergenic
1052806997 9:33022298-33022320 GTCAGTAAACATTTAAAACATGG + Intronic
1055111947 9:72568309-72568331 GTAAGAAACATTTTAGAATAGGG - Intronic
1057479229 9:95431162-95431184 GTTTGAAGACCTTTAAAATAAGG + Intergenic
1058029366 9:100178012-100178034 TCCAGCAAACCTGTAGAATAGGG + Intronic
1058175803 9:101736161-101736183 GTCAGAAATCCTCCAGAATGTGG + Intronic
1058287918 9:103203741-103203763 TTCAGGAATCCTCTAGAATATGG - Intergenic
1059098697 9:111447668-111447690 GTTGGAAAACTTTTGGAATAGGG - Intronic
1059703385 9:116797361-116797383 GTCAGAAAACCTTGGAAACATGG + Intronic
1060123578 9:121019812-121019834 CTCAAAAAACCTTTGAAATAGGG - Intronic
1186064322 X:5745257-5745279 ATGAGAAAACATTTAGAAAAGGG + Intergenic
1190445542 X:50520325-50520347 GACAGAAAAGGGTTAGAATAGGG - Intergenic
1193376140 X:80764276-80764298 GGGAGAAAATCTTCAGAATATGG + Intronic
1193866644 X:86740186-86740208 GTCACAACATCTTTTGAATAAGG + Intronic
1194093498 X:89605779-89605801 GTTAGAACACATTTAGAATTAGG + Intergenic
1195416391 X:104624258-104624280 TTCAGAACACTTTTGGAATACGG + Intronic
1195890538 X:109688774-109688796 GGAAGAAAACCTGAAGAATATGG - Intronic
1196553591 X:117060336-117060358 GTCAAAAGACCTTTAGAAGGAGG + Intergenic
1197354600 X:125421924-125421946 GTCAGAAAATCTGTGCAATACGG + Intergenic
1198223932 X:134628197-134628219 TTCACAACACCTTCAGAATAAGG + Intronic
1198439283 X:136646274-136646296 GGCAGAAGCCCTTAAGAATAGGG + Intergenic
1199145819 X:144365505-144365527 GTCAGAAAATATTTTGTATAGGG - Intergenic
1200446126 Y:3261882-3261904 GTTAGAACACATTTAGAATTAGG + Intergenic
1201932631 Y:19369143-19369165 GGCAGAAAACATTTATAAAAAGG + Intergenic