ID: 974391446

View in Genome Browser
Species Human (GRCh38)
Location 4:61275148-61275170
Sequence CTGTTCATACAACTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974391442_974391446 -9 Left 974391442 4:61275134-61275156 CCCCAAACTACATACTGTTCATA 0: 1
1: 2
2: 11
3: 103
4: 334
Right 974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG 0: 1
1: 0
2: 1
3: 7
4: 116
974391441_974391446 3 Left 974391441 4:61275122-61275144 CCTGCTATACTGCCCCAAACTAC 0: 1
1: 0
2: 0
3: 3
4: 82
Right 974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG 0: 1
1: 0
2: 1
3: 7
4: 116
974391443_974391446 -10 Left 974391443 4:61275135-61275157 CCCAAACTACATACTGTTCATAC 0: 1
1: 0
2: 0
3: 21
4: 169
Right 974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG 0: 1
1: 0
2: 1
3: 7
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974391446 Original CRISPR CTGTTCATACAACTGGAACA AGG Intronic
910600572 1:89027500-89027522 CTGTTCTTGCAAGTGTAACATGG + Intergenic
911438529 1:97895177-97895199 CTTTTCATACTACTTGAAAAAGG - Intronic
912853364 1:113146178-113146200 GTGTTCATACAGCTGGCAAACGG + Intergenic
917196231 1:172468812-172468834 CTGTTTATGAAAATGGAACATGG + Exonic
922425536 1:225489195-225489217 CTATTCATATAATTGGAGCATGG + Exonic
923168765 1:231393655-231393677 CTGTTTATACCACTGGAAACAGG - Intronic
1067563372 10:47319761-47319783 CTTTTCATACAAATGGACCCTGG - Intergenic
1067927881 10:50529031-50529053 TGGTTCCTACAGCTGGAACATGG + Intronic
1069597955 10:69684805-69684827 AGGATCATACAGCTGGAACAGGG + Intergenic
1077706568 11:4492434-4492456 GTGTTCATATAACATGAACAAGG + Intergenic
1080086102 11:28284708-28284730 CTATTAATATAACTAGAACAAGG + Intronic
1081967415 11:47178093-47178115 CTGTTCCTGCAACTGGGTCAAGG + Intronic
1087164456 11:94987166-94987188 CTGTGAATGCAAATGGAACAAGG + Intronic
1089661040 11:119985446-119985468 CAGTTCATGGAACTGGGACAAGG - Intergenic
1090372301 11:126265008-126265030 CTTTTCAAACAACTGCACCATGG + Exonic
1093147767 12:15587314-15587336 AAGTTCATGCAACTAGAACATGG + Intronic
1097949152 12:65407427-65407449 CTTTACCTACAGCTGGAACAAGG - Intronic
1099910806 12:88830848-88830870 TTGCTCATACAAGTGCAACATGG + Intergenic
1101254092 12:102960551-102960573 ATTTTCATAAAACTGGACCAGGG - Intergenic
1102282332 12:111628172-111628194 CAGTTCACACAACTAGAAAAGGG + Intergenic
1103619255 12:122176308-122176330 CTGTTCCTAGAACGGGAAGAGGG + Intronic
1105658083 13:22462367-22462389 CTGTCCAGAGAACTGCAACAGGG + Intergenic
1106573619 13:30954001-30954023 CTGTTTACTCAGCTGGAACATGG + Intronic
1109705973 13:66092952-66092974 CTGTTTATCCAACTGAAGCAGGG - Intergenic
1110212630 13:72991402-72991424 CTGATTATACAACTGAAACTTGG - Intronic
1110317416 13:74126826-74126848 CTTTTCAAATAACTGGCACATGG - Intronic
1110404190 13:75130813-75130835 CAGTCCTTAGAACTGGAACAGGG - Intergenic
1113358774 13:109609296-109609318 CTGTTAATAGATCAGGAACACGG - Intergenic
1113433298 13:110268723-110268745 CTCTTAACACAACTGGGACAAGG + Intronic
1114827992 14:26104931-26104953 GAGTACATAAAACTGGAACATGG + Intergenic
1116780119 14:49227794-49227816 CTGTTCATGAAACTGGAACATGG - Intergenic
1124102146 15:26705546-26705568 GTGTTGATACAACTCAAACATGG + Intronic
1126553220 15:49955423-49955445 CTGTTCATAGAAATGTAAAATGG + Intronic
1127107594 15:55633518-55633540 ATTTTAATACAAATGGAACAAGG - Intronic
1127282294 15:57502754-57502776 CTGAATATACAACTTGAACAAGG - Intronic
1127853602 15:62936462-62936484 CAGTTAATACAAATGGAATATGG - Intergenic
1128204088 15:65835223-65835245 CTTTTCATACAACTGTAACTGGG + Intronic
1130798780 15:87239062-87239084 CTGTTCATACACCATAAACAAGG + Intergenic
1139115569 16:63947690-63947712 CTGTTCATGTAACTTGAGCATGG + Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1143306380 17:5950567-5950589 ATGATCATGGAACTGGAACAGGG - Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1151000625 17:70371099-70371121 CTGTTTATTCAATTGGAAAATGG - Intergenic
1152056133 17:78028329-78028351 TTGTTGACACCACTGGAACAAGG + Intronic
1154148393 18:11885698-11885720 CTGTTCCTCCAACTGAAAGATGG + Exonic
1155652989 18:28162812-28162834 CTGTTCAGACATCTGTAAGATGG + Intronic
1156183264 18:34630745-34630767 CTGTTCATGCAGCTGGAAGGTGG + Intronic
1156901145 18:42301630-42301652 CTTTTCATACTTCTGCAACATGG + Intergenic
1159479567 18:68971013-68971035 ATGTTCATACTTCTTGAACATGG - Intronic
1160544498 18:79643625-79643647 CTGATCACACAAATGGATCAAGG + Intergenic
1162656555 19:12135685-12135707 CTGTTCATTGATTTGGAACATGG - Intronic
1167979250 19:53259058-53259080 CTATTTATACAACTGGCAAATGG + Exonic
1168154917 19:54467985-54468007 CAGTTCATACAGCTGGCAAAGGG - Intronic
929491484 2:42400433-42400455 CTGTTCCTACATCTGGACCTTGG + Intronic
930260688 2:49142679-49142701 CTGTTAATTCAAGTGAAACAAGG + Intronic
930915330 2:56679828-56679850 CTATTCAAACAACTGAAAAATGG - Intergenic
936672695 2:114676629-114676651 CGATTCATATGACTGGAACAAGG + Intronic
937967556 2:127525726-127525748 CTATGCATGCAACTGAAACATGG + Intronic
938765678 2:134459423-134459445 CTGTTCCTGTAACAGGAACAAGG + Intronic
939186890 2:138871735-138871757 CTGTTTATCAAAATGGAACAAGG + Intergenic
941514906 2:166461499-166461521 CTGTTATTGTAACTGGAACATGG + Intronic
941748918 2:169115222-169115244 CTGTTGGAAGAACTGGAACAAGG + Intergenic
947355537 2:229291149-229291171 TTCTTCAAAGAACTGGAACATGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1172415876 20:34767248-34767270 CTGATCATAGAATTGGAACTAGG - Intronic
1172657908 20:36548217-36548239 CTCTGCATGCAAGTGGAACAGGG + Intronic
1173314220 20:41929313-41929335 CTGTACATAAAAGTGGAACTTGG + Intergenic
1181519787 22:23438666-23438688 CTGTTGATACCACAGCAACATGG - Intergenic
952536867 3:34320659-34320681 TAAATCATACAACTGGAACATGG - Intergenic
954172317 3:48814616-48814638 CTGGAAATACAAATGGAACAAGG - Intronic
956703206 3:71977008-71977030 CTGTTCCTATACCTGGAATATGG + Intergenic
959039406 3:101403699-101403721 CTGATAAAACAACTTGAACAAGG + Intronic
961414712 3:126748869-126748891 CTGTTTCTCCAACTGGACCAGGG - Intronic
961570986 3:127798676-127798698 CTGTTGACACAACAGGAATATGG - Intronic
970986489 4:22165074-22165096 TTGTTTTTACAACTGGAACAAGG - Intergenic
971001260 4:22325261-22325283 CTGTTTATACAAGTGTAAAATGG + Intergenic
971464841 4:26946142-26946164 ATCTTTATACAACTGAAACATGG - Intronic
972588419 4:40460500-40460522 CAGTTCACTCAACTGGAAAATGG + Intronic
974391446 4:61275148-61275170 CTGTTCATACAACTGGAACAAGG + Intronic
978015058 4:103734018-103734040 CTGTTGATGCAACTGGAAAATGG - Intergenic
980481635 4:133395323-133395345 GTGTTCAGACAAGGGGAACAAGG - Intergenic
981673900 4:147318975-147318997 TTGTTTATCCAACTGTAACATGG + Intergenic
983870008 4:172814197-172814219 GTGTTCCCACAACTGAAACATGG + Intronic
985677443 5:1239311-1239333 CTGTACAGACACCAGGAACAGGG - Intronic
986097775 5:4576982-4577004 CTCTTCAAGCCACTGGAACAAGG + Intergenic
986139721 5:5018176-5018198 CTGTTCAGAGAAATGGAACAAGG - Intergenic
987286720 5:16465111-16465133 CTGTTCAAACCACTGGAGCCGGG + Exonic
991163582 5:63534197-63534219 TTCTTCCTAAAACTGGAACAAGG + Intergenic
994176147 5:96713542-96713564 CTCTTCATTTGACTGGAACATGG + Intronic
994975366 5:106797545-106797567 CTGTTCATAAAAATGTATCAAGG - Intergenic
996595538 5:125198140-125198162 CTGTTCATACAAATCCAGCAAGG + Intergenic
999304560 5:150511343-150511365 TTGTTCTTGCAACTAGAACATGG - Intronic
1001791273 5:174459688-174459710 CAGTTCATGGAATTGGAACAGGG - Intergenic
1004427600 6:15516951-15516973 CTGACCAAACACCTGGAACATGG - Intronic
1004982101 6:21036498-21036520 CTGTTGATACTACTGGCTCAAGG + Intronic
1006047125 6:31307822-31307844 CTGCTCAGACACCTGGAGCATGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1011101622 6:83728445-83728467 CTGGTCAAACAACATGAACAGGG + Intergenic
1012470196 6:99564089-99564111 CTGTTAATACAAATGGAAATTGG - Intronic
1012747035 6:103104692-103104714 CTGAGAAAACAACTGGAACATGG - Intergenic
1013034359 6:106365827-106365849 CTTTTCCTCCAACTGAAACAAGG - Intergenic
1013834924 6:114323392-114323414 CTGTTCATACCAATAGTACAAGG + Intronic
1014157688 6:118130145-118130167 CTGTTTCCACAACTGTAACATGG + Intronic
1018770520 6:166966840-166966862 CTGTGCATCCATCTGGACCAGGG + Intergenic
1021744571 7:23725856-23725878 CTTTTTATACAACTCTAACAAGG + Intronic
1022058874 7:26770443-26770465 CTGTTCATTCCCCTGGAAAAGGG - Intronic
1022371186 7:29773105-29773127 ATGTTCAAAAGACTGGAACAGGG + Intergenic
1022411860 7:30145110-30145132 ATGTTCAAAGACCTGGAACAAGG - Intronic
1022431846 7:30331818-30331840 ATGTTAACACAAATGGAACACGG - Intronic
1023284763 7:38607621-38607643 CTGTTTCTACTACTGGAAAATGG + Intronic
1024109133 7:46127460-46127482 CTGTTCCCACAACTGTAACATGG + Intergenic
1026145834 7:67745703-67745725 CTGATCATTCAACGGGAACATGG - Intergenic
1027510467 7:79072916-79072938 AAGATCATTCAACTGGAACAGGG - Intronic
1027724900 7:81791743-81791765 CTGCTCATCCAACTTGACCATGG - Intergenic
1043342067 8:79251960-79251982 ATGTACACACAACTGTAACAGGG + Intergenic
1044792519 8:95862759-95862781 CTGTGCATAGAACTGGCACAAGG + Intergenic
1046186133 8:110722165-110722187 TTGTTCATATGACTGGATCAAGG - Intergenic
1046258070 8:111727159-111727181 CTGCTCATATCACTGGGACAGGG - Intergenic
1048175149 8:132145224-132145246 CTGTATATACAAGTTGAACATGG - Intronic
1055297556 9:74850069-74850091 CTCTTCAGAGAACTAGAACAGGG + Intronic
1057078257 9:92152356-92152378 CTGTTCTAACAACTGAAAAACGG + Intergenic
1188303378 X:28532384-28532406 CTGTTCCTACAACACTAACAGGG + Intergenic
1193829981 X:86278694-86278716 CTGTTCATTCCCCTGGAAAAGGG + Intronic
1197555300 X:127945963-127945985 GGGTTCATACCACTGGAAAAAGG - Intergenic
1199294651 X:146143436-146143458 CAGTTCAAACATCTGGCACATGG + Intergenic