ID: 974392200

View in Genome Browser
Species Human (GRCh38)
Location 4:61285889-61285911
Sequence TCTCCTTTGCATGAGTTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 174}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974392200 Original CRISPR TCTCCTTTGCATGAGTTGGA GGG (reversed) Intronic
902650597 1:17834860-17834882 TCTACTGTGCATGAGATGGGAGG - Intergenic
903773360 1:25777967-25777989 CCTCCTTTGCCTGGGATGGAGGG + Intronic
904119108 1:28184477-28184499 TCTCCTGTACGTGAGATGGAAGG - Intronic
906111515 1:43326216-43326238 TCTCATGTCCATGAATTGGAAGG + Intergenic
906283294 1:44568586-44568608 ACTCCTTTGCAGGATTTGGAAGG + Intronic
906609878 1:47193884-47193906 ACTTCTTTGCATGGGTTTGAGGG + Intergenic
906870900 1:49479607-49479629 TGTCCTTTGCATGACATGGATGG - Intronic
907689968 1:56653840-56653862 TCTTCTGTGCATCACTTGGAAGG + Intronic
910346156 1:86241076-86241098 TCTCCTTTTCATTTTTTGGAAGG - Intergenic
911710590 1:101067106-101067128 CCTCCTTTGCAGGACATGGATGG - Intergenic
913343434 1:117783158-117783180 TGTCATTTGCAGGAGTGGGAAGG + Intergenic
913387769 1:118278296-118278318 TCTCCTGTGGAGGAGTGGGATGG + Intergenic
917104897 1:171482680-171482702 TCTCCTTAGCAGCACTTGGATGG - Intergenic
917460296 1:175223456-175223478 TCACCTGTTGATGAGTTGGAGGG - Intergenic
919598744 1:199596594-199596616 TGTCCTTTGCAGGAAATGGATGG - Intergenic
922602634 1:226868953-226868975 TCTCCTTTTCATGTGTTTGTTGG - Intergenic
924061672 1:240181494-240181516 CCTTCTTTGTATGAATTGGAAGG + Intronic
1063975458 10:11412053-11412075 TCTGCTCTGCAAGAATTGGATGG + Intergenic
1064583458 10:16816931-16816953 TCTCCCGTGGATGAGCTGGAAGG - Intronic
1070949346 10:80418554-80418576 TCTCCCTTGCAGGACTTGGCCGG - Intronic
1073879568 10:107965085-107965107 TCTCCTTTCCATTAGTAGCATGG - Intergenic
1075301936 10:121332735-121332757 TTTCCTCTGCATGTTTTGGATGG - Intergenic
1075903608 10:126062816-126062838 TCTCCTTTTCTTGAGTTACAAGG - Intronic
1078975287 11:16467475-16467497 TGTCCTTTGCAGGACATGGATGG + Intronic
1079002365 11:16768970-16768992 TATCCGTTGCAGGAGTGGGAGGG + Intergenic
1079477723 11:20848798-20848820 TCTCTTTTAGAAGAGTTGGAAGG + Intronic
1080703247 11:34663888-34663910 TTTCCTTTGCATGCGTGTGATGG + Intergenic
1081254815 11:40879380-40879402 TCATCTTTCCATGAGTTGGGTGG - Intronic
1081307330 11:41529538-41529560 TGTCCTTTGCATGAGATAGAAGG + Intergenic
1085141304 11:74144754-74144776 TGTCCTTTGCAGGACATGGATGG - Intronic
1085876606 11:80414834-80414856 GCTCCTTTCCATTAGTTTGATGG + Intergenic
1087815000 11:102648618-102648640 TCCCCGATGGATGAGTTGGAAGG - Intergenic
1087822141 11:102724605-102724627 TCTCCTTTTAGTGATTTGGAGGG - Intronic
1090586941 11:128223197-128223219 TGTCCTTTGCAGGACATGGATGG - Intergenic
1092652567 12:10650253-10650275 TCTCCTTTACTACAGTTGGATGG - Intronic
1093689307 12:22091559-22091581 TCTCCTTTGCCTTACTCGGATGG + Intronic
1094151208 12:27285820-27285842 TCTTCTTTGTATGATTTTGAAGG + Intronic
1094220776 12:27991014-27991036 TCTCATGTACATGAATTGGAAGG + Intergenic
1094300352 12:28957808-28957830 TCTCCTTTGAAAGAAATGGAGGG - Intergenic
1097036360 12:56127285-56127307 TCACATTTGCCTGAGTTAGAAGG - Exonic
1099186883 12:79524807-79524829 TGTCATTTGCATTATTTGGATGG - Intergenic
1101308365 12:103553909-103553931 TTTCCTTTGCACCAGTTTGAGGG + Intergenic
1102137289 12:110586030-110586052 TGTCCTGTGCATGCGTTGGAGGG + Intergenic
1102541475 12:113622477-113622499 TCTCCTTTGCAAGAGCTGAAGGG - Intergenic
1104796459 12:131523204-131523226 TATCCTTTGCAGGACATGGATGG + Intergenic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1107542304 13:41402827-41402849 TCCCCTTTGCCTGAGTGTGAGGG + Intergenic
1108151957 13:47545383-47545405 TCTCCTTGGCTTGAATTGCAGGG - Intergenic
1108155535 13:47580628-47580650 TCTCCTTTGCTTAATTTGGTGGG - Intergenic
1108340220 13:49492061-49492083 GCTACTTTACATGAGTAGGATGG + Exonic
1108345797 13:49545973-49545995 TCTGCATTGCATGGGGTGGAGGG - Intronic
1112214921 13:97420204-97420226 TCTCCTCTGGAAGAATTGGATGG + Intergenic
1113022262 13:105900423-105900445 TCTCTTTTGCATGAACAGGATGG - Intergenic
1113659944 13:112099641-112099663 TCTCCTTTGGGTGAGGTGGCTGG + Intergenic
1114829139 14:26118231-26118253 TGTCCTTTGCAGGACATGGATGG + Intergenic
1116533617 14:46004135-46004157 TCTTCTTTGCATGCTTTGGAAGG + Intergenic
1117511368 14:56454787-56454809 TATCCTGTGCATGGCTTGGAGGG + Intergenic
1120740963 14:88108388-88108410 TCTCCTTCTCGTCAGTTGGAAGG - Intergenic
1121660758 14:95633286-95633308 TCTGCATTGCATGTGCTGGAAGG + Intergenic
1121928087 14:97947495-97947517 TCTCTTTAGCATGACTTTGAAGG + Intronic
1122305084 14:100759715-100759737 TCTCCTTAACAGGAGTTGCAAGG + Intergenic
1126331045 15:47531850-47531872 TGTTCTTTGCATGTGTTGGAGGG + Intronic
1128397271 15:67240966-67240988 TCTCTTTAGCATGAATTAGAAGG + Intronic
1128842898 15:70864445-70864467 TTTCCTTTGCCTAATTTGGAAGG + Intronic
1130109310 15:80951670-80951692 TGTCCTTTGCATTGCTTGGAAGG + Exonic
1130929459 15:88412649-88412671 TCTCCTTTGCATCAGTTCTGAGG + Intergenic
1133355210 16:5131125-5131147 ACCCATTTGCATGAGCTGGAGGG - Intergenic
1133627132 16:7581244-7581266 TCTGTTCTGCAGGAGTTGGAAGG - Intronic
1135933561 16:26760052-26760074 TCTCATTGGCATGAGGTGGAAGG - Intergenic
1138293058 16:55864345-55864367 TTTCCTTGGCATCAGTTGGCAGG - Intronic
1139213861 16:65108341-65108363 TCACCAATGCATTAGTTGGAAGG + Intronic
1140982841 16:80127197-80127219 TCTCATTTGCCTGGGATGGAAGG - Intergenic
1141828273 16:86495805-86495827 TCAACTTTGGAGGAGTTGGAAGG + Intergenic
1144379147 17:14675776-14675798 TCTCCTGTCCCTGACTTGGATGG - Intergenic
1146732345 17:35204599-35204621 TATCCTGTGCATGACTTGGAGGG - Intergenic
1148143001 17:45341717-45341739 TCTCCTTTGCCAGAGGAGGATGG + Intergenic
1148884787 17:50764435-50764457 GCTCCTTTTCATGATTTGGGTGG - Intergenic
1151973777 17:77472474-77472496 GCTCCTTTGCAGGACCTGGAAGG - Intronic
1154302811 18:13209246-13209268 TGTCCTTTGCAGGATGTGGATGG - Intergenic
1156785995 18:40916011-40916033 TCTCCTTTGTATAATTTGCAGGG - Intergenic
1158630469 18:59109589-59109611 GCTGCTGTGCCTGAGTTGGAAGG + Intergenic
1160081765 18:75734559-75734581 TGTCCTTTGCAGGACATGGATGG - Intergenic
1164377483 19:27701229-27701251 TATCCCTTGCATGGCTTGGAGGG - Intergenic
1164822863 19:31263883-31263905 TCTCCATGGAATGAGTTGTACGG + Intergenic
1165381553 19:35485115-35485137 TCTCCTTTGTGTGTATTGGAAGG + Intergenic
1165622001 19:37255961-37255983 TCTGTTTTGCATGCATTGGAAGG + Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
925678434 2:6391121-6391143 TCTCCTTTTCATGAGAAGCACGG + Intergenic
926349325 2:11981072-11981094 TGTGGTTTGCATGAGTTGGACGG - Intergenic
927272628 2:21229489-21229511 TCTCCTGTGCAAGAATTGTAAGG + Intergenic
928904107 2:36353479-36353501 CCTCCTCTGCAAGAGTGGGAGGG + Intergenic
930191593 2:48465723-48465745 TGTCCTTTGCAGTACTTGGATGG - Intronic
931117925 2:59184523-59184545 TGGCCTTTGCATGAGGGGGAGGG + Intergenic
931188065 2:59972799-59972821 TCTCCTTGGAATGATTTGAAGGG - Intergenic
932750909 2:74371166-74371188 TCTCCTTTGCAGGAGGAGGAGGG - Exonic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
937104813 2:119300470-119300492 ACTCCTTAGCATGACTTGTAAGG + Intergenic
937834668 2:126460145-126460167 TCTCCTTGGCATGAATTGGGTGG - Intergenic
938404964 2:131027080-131027102 CCTCCTGGGCATGCGTTGGAGGG - Intronic
944245595 2:197527262-197527284 TCTCGTGTGCATGAGTAAGAAGG - Intronic
946908815 2:224441482-224441504 TCTCCTTTGGATGAGGTTTATGG - Intergenic
947218239 2:227768394-227768416 TCTCCTTTTCAGGAGCTGCAGGG + Intergenic
947608186 2:231503969-231503991 TCTCCTGTGCTTGAGCTGCATGG - Intergenic
1172536082 20:35674397-35674419 TCTCCTTTGCATATGTGGAAGGG - Exonic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181027224 22:20133045-20133067 TCACCTTTGCAAGAGTTTGGGGG + Intronic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181507674 22:23371363-23371385 TTTCCTTGGCATCAGTTGGCAGG - Intergenic
1181683074 22:24509263-24509285 TCTCCTATGCAGGGGATGGAGGG - Intronic
1184212940 22:43047343-43047365 CCACCTTTCCATGTGTTGGAAGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
954122713 3:48509223-48509245 TCTCATTTGCATCAGAAGGATGG - Intergenic
955709125 3:61760506-61760528 TCTGCTTATCATGACTTGGAGGG + Intronic
956687811 3:71847400-71847422 TATCATTTGCAGGAGATGGAGGG - Intergenic
957059054 3:75466771-75466793 ACCCATTTGCATGAGCTGGAGGG - Intergenic
959100067 3:102000329-102000351 TTTCATGTGCATGATTTGGAAGG + Intergenic
959869843 3:111313707-111313729 TCTTCTTTGTAAGAGTAGGAAGG + Intronic
960297295 3:115959913-115959935 TTCCCTTTACATGAGTTGGGGGG - Intronic
960452594 3:117828835-117828857 TCTCCTTTTCCTTAGTTTGAAGG - Intergenic
961203243 3:125060973-125060995 TCTGGTTTGCATGGGTTGGATGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963532545 3:146489006-146489028 TGTCCTTTGCAGGACATGGATGG + Intronic
964643389 3:158933504-158933526 TTTCCTTAGCATGGATTGGAAGG + Intergenic
968376042 4:42344-42366 TATCCTGTGCATGGCTTGGAGGG - Intergenic
969002967 4:3996958-3996980 ACCCATTTGCATGAGCTGGAGGG - Intergenic
969455375 4:7297139-7297161 TCTCCTCTGCATTAGGTGGAGGG + Intronic
969810967 4:9647858-9647880 ACCCATTTGCATGAGCTGGAGGG + Intergenic
970706327 4:18807846-18807868 TATCATTTTCATGAATTGGAAGG + Intergenic
974157229 4:58089676-58089698 TCCCCTTTGCATGTCTTTGAAGG - Intergenic
974392200 4:61285889-61285911 TCTCCTTTGCATGAGTTGGAGGG - Intronic
975939511 4:79625619-79625641 TCACATTTGCATGATTTTGAAGG - Intergenic
978627092 4:110698991-110699013 TCTCATGTTCATGAATTGGAAGG - Intergenic
978658979 4:111100429-111100451 TATCCTGTGCATGGCTTGGAGGG - Intergenic
981721591 4:147807187-147807209 TCTCCATTTCATGAATTGGGGGG - Intronic
981953395 4:150439653-150439675 TCTGCTTTGCTGCAGTTGGAAGG + Intronic
985520142 5:370409-370431 TCTCCCGTCCAGGAGTTGGATGG - Intronic
987611064 5:20203330-20203352 TCTCCTTTGGCTGAGTTACAGGG - Intronic
988661087 5:33269349-33269371 TCTCCTTTGCATGTGGTAGAAGG - Intergenic
988717546 5:33843007-33843029 TCCCCATAGCATGAATTGGAAGG + Intronic
988736073 5:34022678-34022700 TCACCTTTGCATTTGTTGGGTGG + Intronic
990446676 5:55899599-55899621 ACTCCTTTACACGAGTGGGATGG + Intronic
991237449 5:64416222-64416244 TCTCCTTTGATTGAGTTACAGGG - Intergenic
993071139 5:83165787-83165809 TGTCCTTTGCAGGACATGGATGG - Intronic
993820605 5:92611011-92611033 TATCCTTTGCAGGACATGGATGG + Intergenic
993889903 5:93461172-93461194 TGTCCTTTGCAAGACATGGATGG + Intergenic
993971040 5:94420220-94420242 TTTCCGTTGCATGATTTGCAGGG - Intronic
995670596 5:114598356-114598378 TCTCCTTTGCCTGATTCGGTGGG + Intergenic
997856070 5:137373751-137373773 CCTCCTGTACAAGAGTTGGAGGG - Intronic
1000668121 5:164024329-164024351 TGTCCTTTGCAGGAACTGGATGG - Intergenic
1005902101 6:30225619-30225641 TCTACTTTGAGTGAGATGGATGG + Intergenic
1007679792 6:43626179-43626201 TCTCCTTTACCTGACTTGGGGGG - Intronic
1016057683 6:139595630-139595652 GCTCCTGTGCATGAGCTGCAAGG - Intergenic
1017564768 6:155671661-155671683 TGCCCTTTGCTTGAGTTGAAGGG + Intergenic
1017822076 6:158056831-158056853 TTTCCTTTGCCTGAGCTGCATGG + Intronic
1020830056 7:13084193-13084215 TGTCCATTGCATGTGTTTGATGG - Intergenic
1022179597 7:27906167-27906189 TCTCCTTTCCAAGAGCTGGGAGG + Intronic
1023314526 7:38921610-38921632 CCTTCTTTGCAAGATTTGGATGG + Intronic
1023761288 7:43467475-43467497 GCTCCTTTGCATGAGTTACCAGG - Intronic
1024093113 7:45963713-45963735 TCTCCTTTTAAAGAGTTGGGTGG + Intergenic
1024568488 7:50704704-50704726 TCTCTTTTGCATGAATAGGAGGG - Intronic
1026231891 7:68491093-68491115 TCTGCTTTGCAGCTGTTGGAAGG - Intergenic
1030342410 7:108395207-108395229 TCTCATTTTCATGAGTAGCAAGG + Intronic
1030610371 7:111682110-111682132 TCTGCTCTGTATGAGTTGAAAGG + Intergenic
1032864990 7:135916239-135916261 TTTCCTTTGTGTGAGTAGGAGGG + Intergenic
1035424506 7:158759690-158759712 TCTCTGTTGCATGGATTGGATGG - Intronic
1035751323 8:1998782-1998804 TCTCCTTTGCATGACTCAGCTGG + Intronic
1040532303 8:48275790-48275812 TCTCCTTTGCAAGAACTGGTTGG + Intergenic
1041909852 8:63077506-63077528 TCTCCTGTGCATGGCTTGGCGGG + Intronic
1041958792 8:63587258-63587280 TTTTCTCTGAATGAGTTGGAAGG + Intergenic
1042020295 8:64366503-64366525 TCTCCTTTGAATAATGTGGAAGG + Intergenic
1042630301 8:70808648-70808670 TATCCTGTGCATGACTTGGAGGG + Intergenic
1043478221 8:80625986-80626008 TCTTGATTGCATGCGTTGGAAGG + Intergenic
1046012606 8:108568723-108568745 TCTTCTTTGCATGTGTGTGAGGG + Intergenic
1046030519 8:108777878-108777900 CCTCCTGTCCATGAGTTGAAAGG + Intronic
1046803625 8:118455906-118455928 TTGCCTTTGAATGAGGTGGAAGG - Intronic
1048231310 8:132644684-132644706 TATCCCATGCATGACTTGGAGGG + Intronic
1048578621 8:135712457-135712479 TCTTCTTTCCCTGACTTGGAGGG + Intergenic
1050804030 9:9651545-9651567 TGTCCTTTGCAGGACATGGATGG - Intronic
1051093564 9:13438475-13438497 TCTCCTTTTCTTGAGTTGCATGG + Intergenic
1051699098 9:19800868-19800890 TCTCTCTTTCATGAGTGGGATGG + Intergenic
1051785633 9:20740055-20740077 TCTCCTTTAAATGTGTTGGATGG + Intronic
1054928345 9:70610927-70610949 TACCCTTTGCCTGAGATGGAAGG + Intronic
1055941994 9:81659287-81659309 TAGCCTTTGCAAGAGGTGGAAGG - Intronic
1058549369 9:106097549-106097571 TGTCCTTTGCAGGACATGGATGG + Intergenic
1060002660 9:119972670-119972692 TCTGCTTTGCCTGGGCTGGAAGG - Intergenic
1060034152 9:120240715-120240737 TTTCCTTTGTAAGAGTTGCAAGG - Intergenic
1203573184 Un_KI270744v1:151806-151828 TATCCTGTGCATGGCTTGGAGGG + Intergenic
1185639914 X:1584069-1584091 GCTCCTTTGCCCGGGTTGGAGGG + Intergenic
1192185822 X:68946235-68946257 CCTCCTCTGCATGGGGTGGAGGG - Intergenic
1194172585 X:90605807-90605829 TTTCCTTTGCAGGACATGGAAGG - Intergenic
1196072499 X:111542004-111542026 TTTCCTTTGCATGACTTTGGTGG + Intergenic
1200518812 Y:4183544-4183566 TTTCCTTTGCAGGACATGGAAGG - Intergenic