ID: 974396557

View in Genome Browser
Species Human (GRCh38)
Location 4:61343462-61343484
Sequence CACACATCACTTTTGATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974396557_974396562 6 Left 974396557 4:61343462-61343484 CCCTGTATCAAAAGTGATGTGTG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 974396562 4:61343491-61343513 AATCTGGCCAGTTCAGGCTCTGG 0: 1
1: 0
2: 1
3: 11
4: 135
974396557_974396561 0 Left 974396557 4:61343462-61343484 CCCTGTATCAAAAGTGATGTGTG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 974396561 4:61343485-61343507 AGAAGGAATCTGGCCAGTTCAGG 0: 1
1: 0
2: 1
3: 24
4: 243
974396557_974396560 -10 Left 974396557 4:61343462-61343484 CCCTGTATCAAAAGTGATGTGTG 0: 1
1: 0
2: 1
3: 15
4: 143
Right 974396560 4:61343475-61343497 GTGATGTGTGAGAAGGAATCTGG 0: 1
1: 0
2: 0
3: 15
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974396557 Original CRISPR CACACATCACTTTTGATACA GGG (reversed) Intronic
903661621 1:24981992-24982014 CACGCGTCACTTTTGTTACCAGG - Intergenic
904174884 1:28620100-28620122 CACATATAACTTTTGAAATAAGG + Intronic
909488121 1:76196865-76196887 TAGACATCACTTTCCATACATGG - Intronic
910893084 1:92038552-92038574 CACACCTCACTTTTGATACCTGG - Intronic
915610823 1:156991261-156991283 CACACATTACTGATGATACTGGG - Intronic
917726481 1:177832542-177832564 CACAAATCCTTTTTGTTACAAGG - Intergenic
919069266 1:192733284-192733306 CACAGATCACTTTCTATCCAAGG - Intergenic
1063479957 10:6366828-6366850 AACACCTCCCTTTTCATACATGG + Intergenic
1068028310 10:51676615-51676637 CACAGATAACTTGTTATACAGGG - Intronic
1070682751 10:78460473-78460495 CACACATCAATTCTGAAAGAGGG - Intergenic
1075945770 10:126431936-126431958 CACACAGAACTTTTGATTCTGGG + Intronic
1077332602 11:1990016-1990038 CAGACATCACTGTTGACACAGGG + Intergenic
1079606601 11:22376514-22376536 CACACATAAGTTTTGACTCAGGG - Intronic
1085130544 11:74034290-74034312 CACATATCACTCTTATTACAAGG + Intronic
1087035348 11:93750272-93750294 CACATACCACTTTTGATACGTGG + Intronic
1087931632 11:103985206-103985228 CACACATATTTTTTGAGACAAGG + Intronic
1090354736 11:126132621-126132643 CACCCTTGACTTTTGATACCAGG - Intergenic
1202815584 11_KI270721v1_random:45192-45214 CAGACATCACTGTTGACACAGGG + Intergenic
1092337846 12:7649577-7649599 CACACATCCTTTTAGCTACAGGG - Exonic
1094869666 12:34586731-34586753 CACACAACAGTTTGGAAACACGG - Intergenic
1099456807 12:82873197-82873219 CACACAACATCTTTGAAACAGGG - Intronic
1101444844 12:104730350-104730372 CACACAAAACCTTTGATGCAGGG + Intronic
1101937269 12:109068477-109068499 CACAGGTCACTTTTTAGACATGG + Intronic
1102831692 12:116008204-116008226 CACACATGTCATTTGACACATGG - Intronic
1108796406 13:54036516-54036538 AAAGCATTACTTTTGATACATGG + Intergenic
1109271510 13:60260775-60260797 CACACATCACTATAGCTAGATGG - Intergenic
1109606070 13:64697697-64697719 CACACATCTTATTTGATCCATGG - Intergenic
1110262619 13:73502493-73502515 CACACATATATTTTGAGACATGG + Intergenic
1110772367 13:79364578-79364600 TACAGATCACATTTGATATAGGG - Intronic
1112992943 13:105536008-105536030 CACACATGACTGTCTATACAGGG - Intergenic
1116202668 14:41818768-41818790 CACACTGCAGTTTTGTTACATGG + Intronic
1117378183 14:55134851-55134873 CACACATCTCTTTTTGAACATGG - Intronic
1118795098 14:69136087-69136109 TACACATCAGTTTTTATAAAAGG - Intronic
1119686238 14:76633938-76633960 CAAAGATCACTTTTGTTCCAGGG - Intergenic
1121593824 14:95143191-95143213 CACATAGCACTTTTGTTACTAGG - Intronic
1126254542 15:46609971-46609993 CACACATTGTCTTTGATACAGGG + Intergenic
1127664117 15:61128169-61128191 CACACAGCAATTATGATATAGGG - Intronic
1135384224 16:22022053-22022075 CTCTTATCACATTTGATACATGG + Intronic
1135571730 16:23554596-23554618 CACACATCAGTGTTGAAGCAGGG - Intronic
1137742943 16:50798746-50798768 CACACCTGACTTTTGAAACCAGG - Exonic
1139065561 16:63309318-63309340 CACACTTAAAGTTTGATACACGG + Intergenic
1139287749 16:65830595-65830617 CACACATGATTTTAGACACAGGG + Intergenic
1146819644 17:35974819-35974841 CACACATGTTTTTTGAGACAGGG + Intergenic
1153068977 18:1082907-1082929 CACACAACACTTTTAAAACATGG - Intergenic
1153530416 18:6040635-6040657 CTCACATCTCTTTTGAGACAAGG + Intronic
1154291060 18:13107054-13107076 CACACATAACATCTGTTACATGG - Intronic
1156503499 18:37574731-37574753 CACACCTCATTTTGGAAACAAGG - Intergenic
1159411926 18:68088777-68088799 CACACATTAACTCTGATACAGGG - Intergenic
1159446853 18:68551385-68551407 CACAGATCAATTTTGATAAATGG + Intergenic
1164222649 19:23209726-23209748 CACACATCACTTTTACTATTAGG + Intergenic
1168653336 19:58108201-58108223 CACACATAACTTATTAAACATGG - Intronic
928747226 2:34429503-34429525 CACAGCTGACTTTTGCTACATGG - Intergenic
931492689 2:62766561-62766583 CCTACCTCACTTCTGATACATGG + Intronic
932890761 2:75595596-75595618 CACACATCACTTCTGATCATTGG + Intergenic
935190150 2:100771066-100771088 CACACACTACTTATGCTACAAGG - Intergenic
937191689 2:120107613-120107635 GACAAATCACATTTTATACATGG - Intronic
937215009 2:120307099-120307121 CACACATATTTTTTGAGACAGGG + Intergenic
940291593 2:152082698-152082720 ACCACATAACTATTGATACAGGG - Intronic
940407158 2:153318191-153318213 TAAACATGACTTCTGATACAAGG + Intergenic
943732059 2:191312824-191312846 CACACCTCACTTTGGAGACCTGG + Intronic
943869458 2:192975414-192975436 CACTCATCACTTGAAATACAGGG - Intergenic
944770396 2:202908451-202908473 CTCACTTCTCTTTTGAGACAGGG - Intronic
947125223 2:226861839-226861861 CCCACATAACTTTGGATAAATGG - Intronic
1169844582 20:9975930-9975952 CACAGATGGCTATTGATACATGG - Intergenic
1170729782 20:18963497-18963519 CATACCTCACTTTGGATACCAGG - Intergenic
1174575253 20:51532695-51532717 AACAGATCACTTTTGAAAAAAGG + Intronic
1175836448 20:61998849-61998871 CACCCATCACCTTTGCTTCAAGG + Intronic
1176993791 21:15529965-15529987 CACATCTCACCTTTGACACATGG - Intergenic
1177252550 21:18613230-18613252 CACACATATTTTTTGAGACAGGG + Intergenic
1178153140 21:29819321-29819343 CACTCATGGCTTGTGATACAAGG + Intronic
1181641561 22:24202941-24202963 CACACCTCACTCTTGTTACATGG + Intergenic
1182100272 22:27652836-27652858 CACACATCCCTGTTGAGATACGG + Intergenic
1182949877 22:34363512-34363534 CAAACAACACTCTTGATACCGGG + Intergenic
1183519373 22:38287701-38287723 CACACTTCATGTTTGAAACAAGG + Intergenic
1184106438 22:42369938-42369960 AACACAACACTCTTGATAGACGG - Intergenic
950817916 3:15726596-15726618 CACATTGCACTTTTGTTACAGGG - Intronic
952212642 3:31244273-31244295 CACTCTTCAATTGTGATACAAGG + Intergenic
952541019 3:34367934-34367956 CACAAATAACTTCTGAAACATGG - Intergenic
953718421 3:45335258-45335280 CAAACATCACTTTTGCAGCAAGG - Intergenic
954832313 3:53432540-53432562 CACACATCACTCTTTAGAAATGG - Intergenic
956730430 3:72191431-72191453 CACGCCTGACTTTTGAGACAGGG - Intergenic
958460819 3:94392543-94392565 CAAAGATCACTTTTGTTAGAAGG + Intergenic
960142402 3:114163766-114163788 CACACATCACTTCTGGTAATAGG - Intronic
965906615 3:173715421-173715443 CACCCATCACTTATGGAACAAGG - Intronic
968219977 3:196929875-196929897 CACACTTCACTCTTGATCCCTGG - Intronic
969697650 4:8744185-8744207 CACACATCACTCCTGACACCTGG - Intergenic
970542657 4:17095313-17095335 CACATATCAGTTTTGCTATAGGG - Intergenic
971635310 4:29049128-29049150 CCCACATCACTTGTGATATCTGG - Intergenic
972921855 4:43952193-43952215 CACACATCACTTTCAAGAAAAGG + Intergenic
974274178 4:59694628-59694650 TACATGTCACTTCTGATACAGGG + Intergenic
974396557 4:61343462-61343484 CACACATCACTTTTGATACAGGG - Intronic
974485770 4:62503947-62503969 CACAAATAATTTTTTATACATGG + Intergenic
974648335 4:64722861-64722883 TACACATAACTGTGGATACAAGG + Intergenic
975802105 4:78071018-78071040 CACTTAACACTTTTGATCCAGGG - Intronic
977164089 4:93673818-93673840 CACACATCAAGTTTGATTTATGG - Intronic
979824530 4:125216821-125216843 CACACCTCACATTGGATACATGG + Intergenic
984594378 4:181651021-181651043 CACACATCATGCTTGATAGAAGG - Intergenic
984891713 4:184499801-184499823 CACACATACCTATTGATATATGG - Intergenic
986856963 5:11880419-11880441 CACACCTGACTTGTGATAGAAGG - Intronic
988544773 5:32145146-32145168 CAAACTTCATTTTTGATACAAGG + Intronic
990028288 5:51223045-51223067 CACACATCATTTTATATACATGG - Intergenic
991295212 5:65073239-65073261 CACACAGCACATATGATACAAGG + Intergenic
994259219 5:97637144-97637166 TACACATCACTTATGATTTAAGG - Intergenic
995431761 5:112087235-112087257 CATACCTCACTTTTGAGGCAAGG - Intergenic
996003333 5:118389502-118389524 CACTCAGCAATCTTGATACAGGG + Intergenic
998046301 5:138989790-138989812 AACACATCACTTCTGATCCTAGG + Intronic
998387377 5:141765324-141765346 AACACATCACTTTTCATATATGG + Intergenic
998663567 5:144268447-144268469 CACAAATAACTTTATATACAGGG + Intronic
999820313 5:155221209-155221231 CACACATGACTTTTGTTCCTGGG + Intergenic
1002544134 5:179927267-179927289 CACACATAATTTTTGACACCTGG + Intronic
1002824338 6:759459-759481 GACACATGGCTTTTGACACATGG + Intergenic
1003760737 6:9176073-9176095 CACACATCATTAGTGAAACATGG - Intergenic
1003799873 6:9651760-9651782 TAAACATCACTTTGGAGACACGG - Intronic
1004524985 6:16399174-16399196 CACATTTAACTTTTGTTACACGG - Intronic
1007710506 6:43820439-43820461 CAGACATAGCCTTTGATACATGG + Intergenic
1008050284 6:46893876-46893898 CACACAGCACTTATCTTACAGGG + Intronic
1013058777 6:106611576-106611598 CACACATGACTTTTAAATCACGG + Intronic
1013968685 6:115988225-115988247 CATATATCATTTTAGATACATGG + Intronic
1014211600 6:118714138-118714160 CACACCTCATTTTTTATAAATGG + Intergenic
1017118506 6:151001826-151001848 AACTCATCACTGTTGACACATGG + Intronic
1018622976 6:165749908-165749930 CTCACATAACTTTTGTGACAAGG + Intronic
1019086135 6:169479635-169479657 CACATATCATTTTAGATACATGG - Intronic
1019095220 6:169574474-169574496 CTCACATCACTTTTGAAAAGCGG - Intronic
1021297236 7:18923000-18923022 TACACAACTCTTTTGACACATGG + Intronic
1023522230 7:41060137-41060159 AACACATCGCTGATGATACATGG - Intergenic
1024215380 7:47244099-47244121 CACACAACCCTTTTGAGACCAGG - Intergenic
1026420925 7:70236127-70236149 CACACACCACTCTGGATACTGGG - Intronic
1028159999 7:87475215-87475237 CACACAACACGTTTGCTCCAAGG + Intronic
1030744295 7:113146429-113146451 AAAACAACACTGTTGATACAAGG - Intergenic
1033271302 7:139935328-139935350 TACACATCACTTTATGTACATGG + Intronic
1034092587 7:148377811-148377833 CGCATATCACTTTTGAACCATGG - Intronic
1034537777 7:151736577-151736599 CACACAACTATTTTGATTCATGG + Intronic
1037295906 8:17399905-17399927 TACACAACAATTTAGATACATGG - Intronic
1038103111 8:24401738-24401760 CACCCACCACATTTAATACAGGG + Intronic
1039203320 8:35121010-35121032 CACTCATCAGTTATGGTACATGG + Intergenic
1042155883 8:65842840-65842862 CAAACAACACTTTTGGTAGAGGG - Intergenic
1043945855 8:86252041-86252063 CACACATCATTGTTGTTCCAGGG + Intronic
1044035146 8:87292832-87292854 CACTCATCACGTGTGAAACAGGG - Intronic
1045328706 8:101136979-101137001 CACACAGCTTTTTTGATACCCGG + Intergenic
1046266982 8:111843564-111843586 CATAAAACACTTTTGAAACAAGG - Intergenic
1048399206 8:134048234-134048256 TACACATCACTATACATACAAGG - Intergenic
1048444709 8:134484680-134484702 CACACAGCACTTTGGTTACTGGG + Intronic
1048937437 8:139368750-139368772 CAGACCTCACTGTGGATACAGGG - Intergenic
1049753843 8:144299136-144299158 CACACAGCACTCTTGAGAGAAGG + Intronic
1051214248 9:14779250-14779272 CACAGAGCACACTTGATACAGGG - Intronic
1051826748 9:21230815-21230837 CTCACTTCACTTTTCCTACAAGG + Intronic
1052223435 9:26055233-26055255 AACACATTCCTATTGATACAGGG + Intergenic
1052278281 9:26703581-26703603 CACACATAACTTTTGCTCAATGG + Intergenic
1053329729 9:37192508-37192530 AAGACAGCACTTTTCATACATGG + Intronic
1056215456 9:84402239-84402261 CACACATTTTTTTTGAGACAGGG + Intergenic
1059998778 9:119939527-119939549 CACACATAACTTTGAATGCAGGG + Intergenic
1186171002 X:6876974-6876996 CACATAACACTTTAGATGCAGGG + Intergenic
1187310179 X:18134249-18134271 CAAACATCATTTTTGTTACTAGG + Intergenic
1188090352 X:25956496-25956518 CACACATCACTTCTAATCCATGG + Intergenic
1188461424 X:30431761-30431783 CACACACCTCTTTCAATACATGG - Intergenic
1192659575 X:73028570-73028592 CACACATCCCTTTTGACATCTGG - Intergenic
1193188454 X:78540472-78540494 CAAACATCACTATTGAGAAATGG - Intergenic
1197299925 X:124765700-124765722 GACACATCTTTTTTGATACATGG - Intronic
1198736632 X:139792670-139792692 CACTCAACACTTTTGACAAAAGG - Intronic
1198923039 X:141752098-141752120 CCCACAGCACTTCTGAAACAGGG + Intergenic