ID: 974400572

View in Genome Browser
Species Human (GRCh38)
Location 4:61400464-61400486
Sequence CAAGATGCCTGGTTTAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974400572_974400575 10 Left 974400572 4:61400464-61400486 CCTCTGTTAAACCAGGCATCTTG 0: 1
1: 0
2: 1
3: 14
4: 101
Right 974400575 4:61400497-61400519 CCATCACTATATATTGTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 109
974400572_974400578 30 Left 974400572 4:61400464-61400486 CCTCTGTTAAACCAGGCATCTTG 0: 1
1: 0
2: 1
3: 14
4: 101
Right 974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG 0: 1
1: 0
2: 0
3: 14
4: 122
974400572_974400576 11 Left 974400572 4:61400464-61400486 CCTCTGTTAAACCAGGCATCTTG 0: 1
1: 0
2: 1
3: 14
4: 101
Right 974400576 4:61400498-61400520 CATCACTATATATTGTTCCTGGG 0: 1
1: 0
2: 0
3: 15
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974400572 Original CRISPR CAAGATGCCTGGTTTAACAG AGG (reversed) Intronic
904117320 1:28172319-28172341 CGTGATTCCTGGTATAACAGAGG - Intronic
905875424 1:41428967-41428989 CAAGATGCCTGCTTGAGCAGTGG - Intergenic
910035374 1:82782077-82782099 CAAGTCTCCTGGTTGAACAGGGG - Intergenic
916691431 1:167193712-167193734 CACAGTGCCTGGTTTAACACAGG + Intergenic
916875077 1:168960466-168960488 CAAAATGCCTGGTTTGTCATAGG + Intergenic
923398482 1:233591052-233591074 CCAGGTAACTGGTTTAACAGAGG + Intergenic
1067660262 10:48232055-48232077 CCAGATACCTGGGTTACCAGAGG + Intronic
1071307975 10:84315916-84315938 CAAGATGCCTGAGTTCAGAGAGG + Intergenic
1074701860 10:116099387-116099409 CATGATGCATGCTTTATCAGTGG - Intronic
1076338293 10:129725324-129725346 CCACATGCCTGGTCTAGCAGAGG - Intronic
1076551710 10:131282727-131282749 CAAAGTGTCTGGTATAACAGAGG - Intronic
1077708859 11:4515574-4515596 GAAGATGCCTGACTCAACAGTGG + Intergenic
1077711885 11:4545519-4545541 GAAGATGCCTGACTCAACAGTGG - Exonic
1087437338 11:98138247-98138269 CAAGCAGCCTTGTTTAGCAGAGG - Intergenic
1090075131 11:123575827-123575849 CAAGATGCCTCTTTCAAAAGAGG - Intronic
1091234598 11:134012628-134012650 GAAGATGAATGGTTTAACTGAGG - Intergenic
1093410870 12:18865261-18865283 CAGGATACCTGGTTATACAGTGG - Intergenic
1094801854 12:34046949-34046971 CAAGGTTCCTGGTTTCAAAGAGG + Intergenic
1095098658 12:38160857-38160879 CAGGATGCCTGGCTTTAAAGGGG - Intergenic
1095114987 12:38342854-38342876 CAAGGTTCCTGGTTTCAAAGAGG + Intergenic
1095681201 12:44978119-44978141 CAAGCTGCCTTTTTTGACAGTGG - Intergenic
1097141867 12:56908843-56908865 AAAAATGCCTGGTTCCACAGTGG - Intergenic
1097171818 12:57119076-57119098 CAAGATGCTTGGCTGCACAGGGG - Intronic
1098118520 12:67208217-67208239 CAAGATGCCTTGATTAATAGAGG - Intergenic
1099428575 12:82553537-82553559 CCTGATGCCTGGTGTCACAGAGG + Intergenic
1099460252 12:82912300-82912322 TAAGATGCCTGGAATAGCAGAGG + Intronic
1099898202 12:88675384-88675406 AATGGTGCCTGGTTTAACAGAGG + Intergenic
1100536383 12:95513981-95514003 CATGTTGTCTGTTTTAACAGTGG + Exonic
1102797871 12:115704639-115704661 CAAATTCCCTTGTTTAACAGAGG + Intergenic
1103628227 12:122237312-122237334 CAAATTGCCTGGTTTACCACTGG + Intronic
1106994902 13:35470486-35470508 CAAGATTTATAGTTTAACAGAGG - Intronic
1110480972 13:75975748-75975770 CAAGATTTCTGATTTAACAATGG + Intergenic
1110902708 13:80843559-80843581 CCAAATGCCAAGTTTAACAGAGG - Intergenic
1112335375 13:98510935-98510957 CTAAATGCCTGGTTTAGCTGTGG - Intronic
1112754336 13:102614598-102614620 CAAGAAGGCTAGTTAAACAGGGG - Intronic
1113031054 13:105993986-105994008 CGATATGCCTGGTTGAAAAGAGG + Intergenic
1113475674 13:110579123-110579145 CAATATGCCTGGTATAAAAGAGG + Intergenic
1119940663 14:78637713-78637735 CACTCTGCCTGGTTGAACAGTGG - Intronic
1121486451 14:94320166-94320188 CAGAATGGCTGGTTCAACAGTGG - Intronic
1121880062 14:97491895-97491917 CCAGATGGCTGGTCTAAGAGTGG - Intergenic
1128434516 15:67632567-67632589 AAAGCTGCATGGTGTAACAGAGG - Intronic
1128549585 15:68589825-68589847 CCAGAGGCCTGGTTTGGCAGTGG + Intronic
1128878824 15:71224481-71224503 CAAGAAGCCGGGGTTAACTGGGG + Intronic
1143173332 17:4942778-4942800 CAAGATGCCAGGGTTCCCAGAGG + Intronic
1143823838 17:9588175-9588197 CAACATGGCTGTGTTAACAGTGG - Intronic
1144149484 17:12429621-12429643 CAAGATGCCTTGTGAAACACAGG - Intergenic
1149095240 17:52832237-52832259 TATGATGCATGGCTTAACAGGGG - Intergenic
1151433027 17:74077722-74077744 CAAGAGGCCAGGTTGAACAGTGG - Intergenic
1152344650 17:79743621-79743643 CCAGATGTCTGGTGTAACAAAGG + Intergenic
1153777809 18:8469061-8469083 CAGGATGCCAGCTTTGACAGAGG + Intergenic
1154047416 18:10919757-10919779 CAAGATTTCTGGTTTAAGATTGG + Intronic
1157368785 18:47091123-47091145 CAGGAACCCTGGTTTAACAGTGG + Intronic
1158425517 18:57336816-57336838 CAAGGTGCCTTGTTTCACTGTGG + Intergenic
1158774598 18:60562660-60562682 CAAGATACCTGGTTCAAGTGTGG + Intergenic
1164522604 19:28990569-28990591 CAAGATGCCTGGTTCATCTGTGG - Intergenic
926424987 2:12732178-12732200 CATGGTGCCTGGATGAACAGGGG - Intronic
927069246 2:19508768-19508790 CAAGATGCCTGGCATAATAGAGG - Intergenic
928298256 2:30104166-30104188 AAAGGTTCCTGGTTTAACTGCGG - Intergenic
930061460 2:47292843-47292865 GAAGATGCCTGGTTCAAAATTGG - Intergenic
930496941 2:52157343-52157365 AAAGATTGCTGGTTTAACAAAGG + Intergenic
932591989 2:73073108-73073130 CAAGTTGCATGGTCTAGCAGGGG - Intronic
933154850 2:78962015-78962037 CAAGATACATGGTTTTGCAGGGG + Intergenic
939907435 2:147934341-147934363 CAAGATCCATGAATTAACAGAGG - Exonic
944080733 2:195785214-195785236 CAAAATTCCTGGTTTAAAAATGG - Intronic
947138931 2:227002788-227002810 CAAGATGCCTGGTCTGCCATTGG - Exonic
947414063 2:229875167-229875189 TAAGATGCCTAGTTCAACTGTGG + Intronic
948433261 2:237934281-237934303 CAAGCTGCCTGGTGTAGGAGGGG - Intergenic
1169222038 20:3829694-3829716 CAAGTTGCCTGTTTTAAAATGGG - Intergenic
1169830839 20:9823196-9823218 CAAGATGCCATCTTGAACAGAGG + Intronic
1169952758 20:11064239-11064261 CAAAAGGCCTGGATTGACAGAGG + Intergenic
1170043280 20:12060590-12060612 GAAGATGCCTGGCTTAACAGGGG - Intergenic
1170526768 20:17246555-17246577 CCATGTTCCTGGTTTAACAGTGG + Intronic
1174699045 20:52589447-52589469 CAAGATGCCTAAATTAAAAGGGG - Intergenic
1177091932 21:16780197-16780219 CAAGAACCCTGAGTTAACAGAGG - Intergenic
1178141900 21:29693796-29693818 AAAGATGCCCGCTTTAAAAGAGG + Intronic
1178883608 21:36467487-36467509 CAAGAAGCCTGGACTGACAGAGG - Intronic
1179492451 21:41750158-41750180 CAGGCTGACTGGTTTGACAGTGG - Intronic
1183133436 22:35862692-35862714 CAAGTAGCCTGGCTTAACAGAGG - Intronic
949781792 3:7697909-7697931 CAAGAAGCCTGGTTTTAAATTGG - Intronic
950604856 3:14069555-14069577 CAAGAGGGCTGATGTAACAGTGG - Intronic
956175885 3:66472568-66472590 CAAAATACCTGTTTTAACACAGG + Intronic
957437669 3:80200078-80200100 CCAGATGGCTGGTGTAAAAGTGG - Intergenic
961353720 3:126320859-126320881 CCAGCTGCCTGATTTAGCAGGGG + Intergenic
972703264 4:41514960-41514982 CAAGAAGCCGGGTTCAACAGTGG - Intronic
974400572 4:61400464-61400486 CAAGATGCCTGGTTTAACAGAGG - Intronic
981800076 4:148645614-148645636 CAATATGCCTAGTTTACCTGTGG + Intergenic
986603921 5:9502755-9502777 CAAGATGCCTGAGAAAACAGGGG + Intronic
987874939 5:23668991-23669013 CCAGAAGCCTGGTTGAAAAGTGG - Intergenic
988156848 5:27464097-27464119 CTAGATGCCTTATGTAACAGGGG + Intergenic
989158576 5:38368518-38368540 GAAGATGCCGGGGTGAACAGCGG - Intronic
992375502 5:76184334-76184356 CAAGATGCCTGGTTTATAGCAGG + Intronic
995582760 5:113618264-113618286 CAAGCTGCCTGGGTCAGCAGCGG + Intergenic
1001252605 5:170158898-170158920 GATGAGGCCTGGTTTAAAAGAGG - Intergenic
1011773797 6:90705924-90705946 AAAGATGCCTTCTTTAACACAGG + Intergenic
1012142108 6:95636862-95636884 AAAGATGCCTGGGTCCACAGCGG + Intergenic
1022624321 7:32019043-32019065 CACTATGCCTGGTTTATCATAGG - Intronic
1023938736 7:44756994-44757016 CATGATGCCTGGTGTGGCAGGGG + Exonic
1028233020 7:88328413-88328435 AAATATGCCTCATTTAACAGAGG + Intergenic
1032323780 7:130908032-130908054 GAACATGCCTGTTTTAAAAGTGG + Intergenic
1037292424 8:17365477-17365499 TAACATGCCTGTTTTAAGAGTGG - Intronic
1037405373 8:18537074-18537096 CAAGCTGCTTCGTTTAACAATGG + Intronic
1038754624 8:30329160-30329182 GAAGATGTCTGGCTTAACAGAGG + Intergenic
1041377428 8:57217791-57217813 CCAGATCCCTGGTTTGGCAGAGG + Intergenic
1042530695 8:69811810-69811832 CATGATCCCTGCATTAACAGAGG + Intronic
1042570414 8:70157452-70157474 TAAGATGTCTGGTTTTACAGAGG + Intronic
1042690346 8:71491540-71491562 CAATATGCCTGAATTAAAAGAGG + Intronic
1043638320 8:82414685-82414707 CAAGTTGGCTGGTATATCAGTGG - Intergenic
1044274342 8:90283203-90283225 CAAGCTGCCAGGATTACCAGTGG - Intergenic
1044988999 8:97778967-97778989 GAAGGTGCCTCGTTTTACAGTGG - Intronic
1046465665 8:114599458-114599480 AAAGATGCATGCATTAACAGGGG - Intergenic
1047023127 8:120798088-120798110 CAAGATGCCCAGTTTAACACAGG + Intronic
1056765517 9:89442373-89442395 AAAGCTGCCATGTTTAACAGAGG - Intronic
1059808731 9:117832455-117832477 CATTGTGCCTGGTTTAAAAGTGG + Intergenic
1186811252 X:13190936-13190958 AAAGATGCTTGCTTTAAAAGAGG + Intergenic
1188968434 X:36582862-36582884 CAAGATCCCTGCTTTAACTCTGG + Intergenic
1196067777 X:111484156-111484178 CAAGACTCTTGGTTTGACAGAGG - Intergenic
1198541659 X:137646329-137646351 CAAGATGCATGATTTAGCAGAGG + Intergenic