ID: 974400574

View in Genome Browser
Species Human (GRCh38)
Location 4:61400497-61400519
Sequence CCAGGAACAATATATAGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974400574_974400578 -3 Left 974400574 4:61400497-61400519 CCATCACTATATATTGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG 0: 1
1: 0
2: 0
3: 14
4: 122
974400574_974400581 7 Left 974400574 4:61400497-61400519 CCATCACTATATATTGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 974400581 4:61400527-61400549 TGTGAATAACTGGCAATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974400574 Original CRISPR CCAGGAACAATATATAGTGA TGG (reversed) Intronic
902141733 1:14362460-14362482 CTACTAACAAAATATAGTGAAGG - Intergenic
903040277 1:20524329-20524351 CCAAGACCAATATATGGAGAGGG + Intergenic
903398963 1:23025007-23025029 CTAGGAACAAGATAGATTGAAGG + Intronic
906052674 1:42887830-42887852 CCAGGAGCAGAAGATAGTGACGG + Intergenic
908019369 1:59884637-59884659 CAAGGCACAATATATGGTGGTGG + Intergenic
910486106 1:87715956-87715978 ACAGGATCAATATATGGTGATGG + Intergenic
911073686 1:93852203-93852225 CCAGTTACAAAATATAGTGGAGG - Intergenic
911263510 1:95715889-95715911 CCAGGAACAACTTATAGGGGAGG - Intergenic
911945228 1:104098843-104098865 CCAGGAAAAATACCTAATGAAGG + Intergenic
912366780 1:109140276-109140298 CAACTAAAAATATATAGTGAGGG - Intronic
916697560 1:167254928-167254950 CCAGGAACAATTTGAAGTGCTGG + Intronic
916726127 1:167525826-167525848 GCAGGAACAATTTAAAGTGTAGG + Intergenic
920109216 1:203575339-203575361 TCAGGAACAGTATCTAGTGTTGG - Intergenic
921528715 1:216252475-216252497 TCAGTTACAAGATATAGTGAAGG + Intronic
921977778 1:221221044-221221066 CCAGGAAAAATATTTATTGGAGG - Intergenic
923213324 1:231826466-231826488 TCAGGCACAAAATATAGGGAGGG - Intronic
924736559 1:246762486-246762508 CCAGGAACATTTTATAAAGAAGG - Intronic
1064332456 10:14406496-14406518 CCAGGAACCAGATAAAGGGATGG + Intronic
1064877016 10:20005657-20005679 GCAGGAACAAGAGAGAGTGAGGG + Intronic
1068236338 10:54238287-54238309 TCAGCAAAAATGTATAGTGATGG + Intronic
1069096878 10:64270003-64270025 AAAGGAACAAAATATAGTGAGGG + Intergenic
1069382600 10:67856153-67856175 CCAGGAAGATAATGTAGTGAGGG - Intergenic
1071417776 10:85457300-85457322 CCACTAAGAATATGTAGTGAGGG - Intergenic
1073569225 10:104562202-104562224 ACAGGAACAATAGACACTGAGGG - Intergenic
1073815628 10:107203494-107203516 CCAGGTACAAGATCTAATGAAGG - Intergenic
1077751921 11:4980466-4980488 CAAAGAACAAAATATAGGGATGG + Intronic
1077801665 11:5545169-5545191 CCAGGACAAAGTTATAGTGAAGG + Exonic
1080790296 11:35516591-35516613 ACAAGAACAATATTTAGCGAAGG + Intronic
1082718218 11:56641090-56641112 TCACAAACAATATATAGTGAGGG - Intergenic
1083788577 11:64969352-64969374 CCAGGAAGAAATTATAGAGAAGG + Intronic
1087815592 11:102654960-102654982 CCAGGAAGAATATTTAGTGGGGG - Intergenic
1094295021 12:28896074-28896096 CAAGGAAGATTATATAGTGATGG + Intergenic
1096222189 12:49837627-49837649 CCAGGAAAAATACATAGAGAAGG + Exonic
1096481944 12:51948096-51948118 CCAGGCACAACATATAGACATGG - Intergenic
1098906976 12:76172413-76172435 CCAGTAGCAACATATTGTGATGG + Intergenic
1101461651 12:104903042-104903064 CCAGAAAGAATTTTTAGTGATGG + Intronic
1101728566 12:107407908-107407930 CCAGGAACGTTGTACAGTGATGG + Intronic
1103053684 12:117802185-117802207 CCAGGAACAAGGTATACTGATGG - Intronic
1105879222 13:24588968-24588990 CCAGAAAAAATATTTAGGGAAGG - Intergenic
1105920614 13:24960090-24960112 CCAGAAAAAATATTTAGGGAAGG + Intergenic
1106909695 13:34450362-34450384 CCAGGAACAATACAAAGAGATGG - Intergenic
1107486921 13:40836954-40836976 CCAGAAAAAATATTTAGGGAAGG + Intergenic
1109050122 13:57469492-57469514 CCAGGAACTATAGATAGTTAGGG - Intergenic
1113496050 13:110730171-110730193 CCAGGAAAGATAGGTAGTGATGG - Intergenic
1116079155 14:40151206-40151228 CTGGGAACAAAAAATAGTGATGG - Intergenic
1116087593 14:40260617-40260639 TCAGGAAAAATATTCAGTGAAGG + Intergenic
1116264519 14:42670066-42670088 CCAGGAACTATAGATAATGGTGG + Intergenic
1116786893 14:49297585-49297607 CCAGGAACAGTCTATAGGCAGGG + Intergenic
1117964724 14:61195092-61195114 CCAGGAAGAATATAGAGAAATGG - Intronic
1118325267 14:64776164-64776186 ACAGGAAAATTATATAGAGAGGG - Intronic
1118667776 14:68089067-68089089 CCAGGAAAAAAAAATAATGATGG - Intronic
1125241934 15:37585986-37586008 CCAGAGACAAGCTATAGTGATGG + Intergenic
1127217614 15:56840625-56840647 CCAGGAGCAATATAAAATTATGG + Intronic
1144367167 17:14555671-14555693 CCAAGAAAAATATCTACTGAGGG - Intergenic
1145185932 17:20794201-20794223 GCAGGAAGAATATAGGGTGAAGG + Intergenic
1146481550 17:33208957-33208979 CCTGGAAACATATATAGAGAAGG - Intronic
1148411186 17:47468647-47468669 GCAGGAAGAATATAGGGTGAAGG - Intergenic
1149009713 17:51843074-51843096 CCAGAAACAAGCTAAAGTGAAGG + Intronic
1149294623 17:55250568-55250590 CCAGGATCTATTTCTAGTGAAGG - Intergenic
1151003683 17:70408439-70408461 CCAGGATCAATATATTTTGTTGG - Intergenic
1156041614 18:32829293-32829315 CAAGGAACAATAGAGAGAGAGGG + Intergenic
1157012044 18:43661538-43661560 CCAGCAAGAATTTCTAGTGATGG + Intergenic
1157624620 18:49040894-49040916 CCAAGAGAAATATTTAGTGAGGG - Intergenic
1159342516 18:67154534-67154556 ACAGTAACTATATATGGTGATGG - Intergenic
1164786027 19:30931713-30931735 CCAGGAACAATGCATAGGAAGGG + Intergenic
925437044 2:3847489-3847511 CCAGGAAAAAAATATCATGAGGG - Intergenic
926344887 2:11936071-11936093 CCAGGATCAATTTCTAGAGACGG - Intergenic
926604783 2:14886536-14886558 CTAGGTACAATTTATAGAGATGG - Intergenic
928559582 2:32466201-32466223 CCAGCTACATTTTATAGTGAAGG - Intronic
930363200 2:50407760-50407782 CAAGGAACCATATCTGGTGAGGG - Intronic
930739048 2:54810756-54810778 CCAGGAACTGTTTAGAGTGATGG + Intronic
936991434 2:118371143-118371165 CAAGGTATAATATGTAGTGATGG - Intergenic
937752012 2:125487334-125487356 CCAAAAACAATATATATTGATGG + Intergenic
939220007 2:139289889-139289911 CTAAAAAGAATATATAGTGATGG - Intergenic
939227445 2:139381919-139381941 CCAGGAAAAATATCCAGTGCTGG + Intergenic
939549056 2:143590774-143590796 ACTGGAACAACATCTAGTGAAGG - Intronic
941150024 2:161903447-161903469 CCTGCAACAATATCTGGTGAGGG + Intronic
941522402 2:166562532-166562554 TCAGGAACAATATCTAGTAAAGG + Intergenic
942258384 2:174130481-174130503 CCAGGAACATTATATTCTGGGGG - Intronic
942508451 2:176669589-176669611 CCAGGAAGTCTATTTAGTGAAGG - Intergenic
942736551 2:179120441-179120463 CCAGGGAGAATATATAAAGAAGG + Intronic
943191876 2:184687255-184687277 CCAGGTTCAATAAATAGTGCTGG - Intronic
946546222 2:220747107-220747129 CCAGGAAAAGTCAATAGTGAGGG + Intergenic
947334178 2:229064269-229064291 CCAGGAACAAAAGAAAGTGATGG + Intronic
1169661627 20:7984649-7984671 ACAGTAACTATATATACTGATGG + Intronic
1169984321 20:11425839-11425861 CCAGGAACAAAATTTAGTTTGGG - Intergenic
1175099874 20:56571262-56571284 GCAGGAGAAAGATATAGTGAAGG + Intergenic
1178633777 21:34284781-34284803 CCAGGAACAATGTTTAATCAGGG - Intergenic
1179432776 21:41335503-41335525 GCAGGAGCAATAGAGAGTGAGGG - Intronic
1179472887 21:41623236-41623258 CCAGGAACCACCTCTAGTGAGGG - Intergenic
950746870 3:15097722-15097744 CAAGCCACAGTATATAGTGAGGG + Intronic
956328856 3:68082715-68082737 CCTGTCACACTATATAGTGAGGG + Intronic
956437344 3:69246808-69246830 CCAGGAACAAGCTCGAGTGAAGG + Intronic
959483951 3:106906831-106906853 CCAGTAACAGTAAATAGTTAGGG + Intergenic
959896831 3:111615721-111615743 CAAGGACCAACATCTAGTGAGGG + Intronic
960132369 3:114071035-114071057 CCAGGGACAACATATAGAAAGGG - Intronic
962916293 3:139906902-139906924 CCAAGAATTAAATATAGTGATGG - Intergenic
964897377 3:161614129-161614151 CCAGGAGCAAGAGAGAGTGAGGG + Intergenic
971137486 4:23885738-23885760 TAATGAACAAAATATAGTGATGG - Intronic
971833052 4:31723327-31723349 CCAGAGACAATATATAAGGAAGG - Intergenic
972098392 4:35379235-35379257 GCAGGAATTATATATACTGAGGG - Intergenic
972190382 4:36584349-36584371 TCAGGAGCAAGATATAGTCAAGG + Intergenic
973328765 4:48891079-48891101 CCAGGAATAGTATGTAGAGAGGG - Intronic
973955670 4:56060618-56060640 CCAGGAACAATTTGGAGAGATGG + Intergenic
974400574 4:61400497-61400519 CCAGGAACAATATATAGTGATGG - Intronic
975312442 4:72917758-72917780 CCAGGAACAAAGTACAGTTAAGG - Intergenic
976551641 4:86403114-86403136 TCAGAAACAAGAGATAGTGATGG + Intronic
977171953 4:93773330-93773352 ACAGGAACTATGTATAGTGCAGG + Exonic
977807258 4:101315783-101315805 CCAGGAACAGAATACAGTCATGG + Intronic
982515670 4:156345621-156345643 TCAGCAACAAAATATAATGAAGG + Intergenic
986957334 5:13169195-13169217 CCAGGAACAAAATATATAAATGG - Intergenic
995812073 5:116118749-116118771 CCAGGAAAAAAAAAAAGTGATGG + Intronic
995976529 5:118043167-118043189 CCTGGAACAATATTTATTCAGGG + Intergenic
996087788 5:119322050-119322072 CAAGGAACAATCTATAGGGAAGG - Intronic
996537223 5:124591122-124591144 CTTGGTACAATATATACTGATGG - Intergenic
997052180 5:130396027-130396049 CCATAGACAATATATAATGAAGG - Intergenic
998642093 5:144022558-144022580 GCAGGAACAAGAGAGAGTGAGGG - Intergenic
1000495766 5:161982450-161982472 AAAGGAACAAAATATAATGAGGG + Intergenic
1006873561 6:37275860-37275882 CCAGGAGCAATAAACAATGATGG - Intronic
1012117411 6:95320032-95320054 ACAGAAAAAATATATAGAGATGG - Intergenic
1012139773 6:95611231-95611253 CCACAAACAATATTTAATGAAGG - Intergenic
1012706833 6:102542015-102542037 CCATGGACAATATATGGTGCTGG + Intergenic
1021352623 7:19613665-19613687 CCAGCAACAGTTTGTAGTGAAGG + Intergenic
1021769269 7:23982574-23982596 CCAGGAATAATAAATATTGCTGG + Intergenic
1024532102 7:50401720-50401742 ACGAGAATAATATATAGTGAGGG - Exonic
1025799845 7:64775464-64775486 GCAGGAGCAAGAAATAGTGAGGG - Intergenic
1027609453 7:80341671-80341693 CCTGGCTCAATATATAGTAAAGG + Intergenic
1030489426 7:110213432-110213454 CCTGCAACAATGTAGAGTGAAGG - Intergenic
1032753232 7:134863638-134863660 ACAGGAAATATCTATAGTGAGGG + Intronic
1032922418 7:136564902-136564924 ACAGGAATACAATATAGTGAGGG - Intergenic
1033907318 7:146221296-146221318 ACTGCAACAATATATACTGAAGG + Intronic
1036594879 8:10202390-10202412 CCTAGAGCAATATATAGTGTGGG + Intronic
1037294959 8:17390294-17390316 GCAGGAACAAGAAAGAGTGAGGG + Intronic
1040539544 8:48340011-48340033 CCAGGAAAAATAACTAATGAGGG - Intergenic
1042223380 8:66495057-66495079 CCATAAACAATATATAGTATTGG - Intronic
1042967163 8:74366115-74366137 TCAGGAATAATATAAATTGAAGG - Exonic
1043230129 8:77789792-77789814 CCAGGAACAACATAGAGCTAGGG - Intergenic
1047296906 8:123578582-123578604 CCAAGGACAATATATACTTAGGG - Intergenic
1048013831 8:130480410-130480432 TCAAGAACAAGATCTAGTGAAGG + Intergenic
1051019038 9:12517751-12517773 CCAAGCACAATAAATATTGATGG - Intergenic
1051136738 9:13931240-13931262 CAAGGAATGATATATAGGGAAGG - Intergenic
1055671291 9:78608842-78608864 TCAGGAACAATATTCAGGGATGG - Intergenic
1057501049 9:95596878-95596900 CCAGAAACAGCATATATTGATGG - Intergenic
1185938984 X:4292474-4292496 CCAGAAATAATATATATTGGTGG + Intergenic
1188215746 X:27474877-27474899 CCAGGCACTATATGAAGTGAAGG + Intergenic
1188346019 X:29066656-29066678 CTAGGAACAAGATAAGGTGAGGG + Intronic
1190026376 X:46927388-46927410 CCAGGGACAACATATTTTGAAGG - Intronic
1193158516 X:78201101-78201123 CCAGGAAGAAGATAGACTGATGG - Intergenic
1195474032 X:105263858-105263880 CCAGGGACAATAAATAGTAGGGG + Intronic