ID: 974400578

View in Genome Browser
Species Human (GRCh38)
Location 4:61400517-61400539
Sequence TGGGATTCCCTGTGAATAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974400574_974400578 -3 Left 974400574 4:61400497-61400519 CCATCACTATATATTGTTCCTGG 0: 1
1: 0
2: 0
3: 13
4: 135
Right 974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG 0: 1
1: 0
2: 0
3: 14
4: 122
974400573_974400578 19 Left 974400573 4:61400475-61400497 CCAGGCATCTTGTAAAAGAGAAC 0: 1
1: 0
2: 1
3: 12
4: 171
Right 974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG 0: 1
1: 0
2: 0
3: 14
4: 122
974400572_974400578 30 Left 974400572 4:61400464-61400486 CCTCTGTTAAACCAGGCATCTTG 0: 1
1: 0
2: 1
3: 14
4: 101
Right 974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG 0: 1
1: 0
2: 0
3: 14
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974400578 Original CRISPR TGGGATTCCCTGTGAATAAC TGG Intronic
905225948 1:36479324-36479346 TGGGATTCTCTGGGAATCCCAGG + Intronic
905730172 1:40292569-40292591 TGGGATTCCCTGTTTCTGACTGG + Exonic
908111392 1:60902100-60902122 TGGGCTTCCCTGAGCATATCTGG + Intronic
919259056 1:195166048-195166070 AGGTATTCCCTGTGAATACTGGG - Intergenic
923025481 1:230200517-230200539 TGAGCTGCCCTGTGAATGACTGG + Intronic
923548673 1:234943787-234943809 TGGCATTCCCTTTGAATAGCTGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063446301 10:6120002-6120024 TGGGATTCTCTGAGAAGAATGGG - Intergenic
1066125456 10:32337423-32337445 AGGGACACCCTGTGAATATCTGG + Intronic
1067972393 10:50987668-50987690 TGGCAATACCTGTGAAAAACTGG - Intergenic
1070236712 10:74635132-74635154 TGGGAAGCCCTGTGAACCACAGG + Intronic
1072306996 10:94117210-94117232 TGAGCTTCCCAGTGAATAAAAGG + Intronic
1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG + Intergenic
1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG + Intergenic
1076611645 10:131729667-131729689 TAGGATTGTCTGTGGATAACAGG - Intergenic
1078671693 11:13371370-13371392 TGGGATTTGCTGTGAATATCAGG - Intronic
1079246032 11:18753023-18753045 AGGGATTGCCTGTGGATATCTGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1094052227 12:26233207-26233229 TGAAATACCCTGTGAATTACTGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1099021431 12:77409482-77409504 TGGAATTACCTGTGAATTATGGG + Intergenic
1105494028 13:20914641-20914663 TGAGATTCCATATGAATGACAGG - Intergenic
1107038058 13:35921154-35921176 TGGGATATCCTGGGAATAATAGG - Intronic
1110132768 13:72027663-72027685 GAGGACTCCCTGTGAATAACGGG + Intergenic
1110762523 13:79246006-79246028 TGAGAATACCTGTGAATATCTGG - Intergenic
1111567971 13:90041710-90041732 TGGAATTCTCTGTGGATAACGGG + Intergenic
1113177844 13:107586409-107586431 TTGGAGTCCCAGTGAATCACAGG - Intronic
1113230922 13:108214519-108214541 ACGGATTCCCAGTGAATACCTGG + Exonic
1113546959 13:111160346-111160368 TGTGATTCCATGTGAATTTCAGG + Intronic
1113626732 13:111853305-111853327 TGGAATTGCCTGTGAATTGCTGG - Intergenic
1115501473 14:34053725-34053747 TGGGATTCCCAGTCAAAACCAGG + Intronic
1118344809 14:64930217-64930239 TGAGAGTCCCTGTGAATGACTGG + Intronic
1122063132 14:99150350-99150372 TGGGGCTCCCTGTGACTCACTGG - Intergenic
1125385274 15:39130400-39130422 AGAGATTCCCTGTGGATCACTGG - Intergenic
1127011530 15:54636045-54636067 TGTGATTCCCTGGCAATAACTGG - Intergenic
1134264695 16:12683178-12683200 TGAGATTCCGTTTGAATAACTGG + Intronic
1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG + Intronic
1137259688 16:46814878-46814900 TGGGATTCCATGTGAATTTTAGG - Intronic
1138628973 16:58278444-58278466 TGGGGTTCCCTGGGTGTAACTGG + Intronic
1139364321 16:66424468-66424490 TGGGATTCCCTGTGAGCGGCTGG + Intergenic
1141289012 16:82700286-82700308 TGGGATGCCCTGTGAACAAAAGG - Intronic
1141355650 16:83344173-83344195 TGGCATTTCCAGTGAATCACGGG - Intronic
1145772408 17:27502945-27502967 TGGCATTGCCTGTCAGTAACTGG - Intronic
1149532968 17:57410131-57410153 TGGGTTTGCCTGTGACTAAGGGG + Intronic
1149724142 17:58875679-58875701 TGTGATTGTCTGTGAATCACAGG - Intronic
1154461421 18:14592085-14592107 TGGGATGTTCTGTGAATATCTGG - Intergenic
1158542639 18:58370569-58370591 TTGCATTCCATGTGAACAACAGG + Intronic
1162665893 19:12211381-12211403 TGAGATTCCCTGTGAATTTTAGG + Intergenic
1163384920 19:16993711-16993733 TGCGATGCCCTGTGAATTTCAGG - Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG + Intronic
932683671 2:73849466-73849488 TGGAATTCTCTGTGGAAAACTGG + Exonic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
940576864 2:155519244-155519266 AGGCATTCCCTGTCAAAAACGGG - Intergenic
940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941706776 2:168667158-168667180 TGGGATTTTCTGTGTTTAACAGG + Intronic
941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG + Intronic
942666747 2:178327787-178327809 TGTTATTCCCTGTTAATAGCAGG + Intronic
943456781 2:188118304-188118326 TGGGAAGTCCTGTGAAAAACTGG - Intergenic
947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG + Intronic
948391858 2:237617495-237617517 TGGGATTAACTGTGATTAACTGG + Intergenic
1169899799 20:10541323-10541345 TGGGATTCCCCTTGCATCACTGG + Intronic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG + Intergenic
1173966319 20:47115424-47115446 TGAGCCTCCCAGTGAATAACAGG - Intronic
1175574838 20:60052999-60053021 TTATATTCCCTGGGAATAACAGG + Intergenic
1182990002 22:34758421-34758443 TGGGATTCATTTTGAAGAACTGG + Intergenic
1183163549 22:36130954-36130976 TGGGATTTCCTGTGAAGAAAAGG - Intergenic
950924258 3:16724380-16724402 ATGTATTCCCTGTGAATAAGCGG - Intergenic
953270583 3:41439084-41439106 TGGGGTTCCCCGTGAACAAAAGG + Intronic
955055322 3:55449719-55449741 TGGGATTGCATGTGAAGAGCAGG - Intergenic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963738880 3:149054536-149054558 TTGGAATCCCTGTGAATATAAGG - Intronic
965205621 3:165716891-165716913 TGGGGTTCCATGAGAAAAACAGG + Intergenic
965771197 3:172182640-172182662 TGGAATTCCCTGCGTTTAACAGG - Intronic
967427868 3:189348223-189348245 CGGGAATCCCTGGGAACAACTGG + Intergenic
969449392 4:7264504-7264526 TGTGATTTCCTGTGGATAGCCGG - Intronic
970187638 4:13478054-13478076 TGAGATTCTCTGTGTACAACTGG + Intronic
970693890 4:18652896-18652918 TGTGATACACTGTGAATATCTGG + Intergenic
970720542 4:18983571-18983593 TCAGATTGCTTGTGAATAACGGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
980759180 4:137205987-137206009 TGTGATTCCATGTGAATTTCAGG + Intergenic
982864221 4:160489884-160489906 TTGGACTCCTTGTGAAAAACAGG + Intergenic
983899444 4:173118106-173118128 AAGGATTCCCTGTCAATAAATGG + Intergenic
984658223 4:182343202-182343224 TGGAATTCACTGTGATTAAAAGG - Intronic
985485873 5:148725-148747 TGAGATTCCCTATGAATTTCAGG - Intronic
985964576 5:3330206-3330228 TGAGAACCCCTGTGATTAACTGG + Intergenic
992609621 5:78495943-78495965 AGGGGGTCACTGTGAATAACAGG - Intronic
996230490 5:121058022-121058044 TGGGATTACAGGTGAATTACAGG + Intergenic
998581305 5:143378989-143379011 TAGGATTCCCTGTGATTCATGGG - Intronic
1003344114 6:5249847-5249869 TGGGATTCAGTGTGAAGAAAGGG + Intronic
1009411325 6:63368437-63368459 TGGGATTCCCAGAGAATGCCAGG + Intergenic
1010144650 6:72653000-72653022 TGTGATTGTCTGTGAATAAATGG - Intronic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016099946 6:140086842-140086864 TGGGCTTCCCTTTGATTAACAGG + Intergenic
1017467705 6:154710170-154710192 AAGTATCCCCTGTGAATAACAGG - Intergenic
1020873215 7:13660551-13660573 TGGGATTCCATGTGAATTTTAGG - Intergenic
1021024740 7:15650865-15650887 TGGGAGTCCCTTTTAATAAAAGG - Intronic
1022526354 7:31040114-31040136 TTGGATTCTCTGTAAATAATGGG + Intergenic
1022776402 7:33532025-33532047 TGGTATTCCCTGAGAGTGACTGG - Intronic
1023324259 7:39035620-39035642 TGGGATTCCCAGTTATTAAAGGG + Intronic
1024197276 7:47071542-47071564 TGGCATTCACTGAGAATAAAAGG + Intergenic
1024244438 7:47458574-47458596 TGGGATGAGCTGTGAAAAACGGG + Intronic
1024876367 7:54028737-54028759 TGGGTTTGCCTGTGCATATCTGG - Intergenic
1024973125 7:55088637-55088659 TGGCTTTCCCTGTGATTATCAGG + Intronic
1026587844 7:71671330-71671352 TGGGACTCCCTGTGACTACCAGG + Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1044891618 8:96842144-96842166 TTTTATTCCCTGAGAATAACTGG - Intronic
1044957668 8:97498305-97498327 TGGGCTTCCCTGTGAAGCCCAGG - Intergenic
1046978997 8:120315930-120315952 TGGGATACCCTGTGTAGAACAGG - Exonic
1047581565 8:126222099-126222121 TGGGATTCCATGAGGAAAACAGG + Intergenic
1048590907 8:135820061-135820083 TGGGATTCCATGGGAGTAATGGG - Intergenic
1051959551 9:22741687-22741709 GAGGATTGCCTCTGAATAACAGG + Intergenic
1055018493 9:71644757-71644779 TAGGATTCCTTGTTAAAAACAGG - Intergenic
1057897878 9:98924327-98924349 AGGGGTTCCCTGTGGCTAACAGG - Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059225718 9:112671123-112671145 TGGGATCCCCTGAGAAATACAGG - Intergenic
1060070219 9:120540583-120540605 TGGAATTCAATGTGAACAACTGG + Intronic
1191030224 X:55961575-55961597 TGGTATGCACAGTGAATAACTGG - Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193269403 X:79511593-79511615 TGGGGTTCCATGAGAAAAACAGG - Intergenic
1193553090 X:82923317-82923339 GGGGGTTCCCTTTGCATAACGGG + Intergenic
1193710080 X:84869166-84869188 AAGGATTCCCTATGAATAAATGG + Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194666016 X:96678376-96678398 TGGCTTTGCCTGTCAATAACAGG + Intergenic
1197121391 X:122897587-122897609 TGTGACTACCTGTGATTAACTGG - Intergenic
1197396855 X:125938217-125938239 TGGGATTCCATGAGCAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic