ID: 974400679

View in Genome Browser
Species Human (GRCh38)
Location 4:61402236-61402258
Sequence AACCCCTTCCTGTACAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974400679 Original CRISPR AACCCCTTCCTGTACAAAAC AGG (reversed) Intronic
900211623 1:1459194-1459216 AACGCCTTCCTGTACCGCACGGG + Exonic
900217403 1:1489237-1489259 AACGCCTTCCTGTACCACATGGG + Exonic
900224431 1:1526494-1526516 AACGCCTTCCTGTACCGCACGGG + Exonic
905973884 1:42161891-42161913 CACCTCTTCCTCTATAAAACTGG - Intergenic
909667093 1:78146890-78146912 AATCCCTTCCTGCTTAAAACAGG - Intergenic
911455276 1:98114529-98114551 ATCCCTTTCCCTTACAAAACTGG - Intergenic
911455571 1:98118586-98118608 TACCTCTTCCTGTACAAGAAAGG - Intergenic
917333926 1:173909533-173909555 AACTCCTTCCTAGACAAACCTGG + Exonic
920868125 1:209769975-209769997 AACCCCTACCTGGGCAAAAGGGG + Intronic
923454112 1:234148123-234148145 TATCCCTTCCTGTACACACCTGG + Intronic
924456525 1:244223167-244223189 AACCCCTGCCTCTACGAAGCTGG - Intergenic
1064232770 10:13544091-13544113 AACCCAGTCCTGTACAATTCTGG - Intergenic
1070319382 10:75343377-75343399 AACCCCTTCCTGGGCAACCCCGG - Intergenic
1077415021 11:2420812-2420834 CACCCCCTCCTGTACCACACGGG - Intronic
1078462758 11:11527400-11527422 AGCTCATTCCGGTACAAAACAGG + Intronic
1090302547 11:125657016-125657038 AATGCCTTTCTGTGCAAAACAGG - Exonic
1091348730 11:134875410-134875432 AACCACTTCCTGTAAAATGCTGG + Intergenic
1092965279 12:13635313-13635335 TTTCCCTTCCTGTAGAAAACAGG - Intronic
1095258455 12:40069663-40069685 AACCGCTTCCTGTAGAAACTAGG - Intronic
1097724937 12:63064610-63064632 AACCCCTTACTTTACAGAAAAGG - Intergenic
1098258228 12:68639755-68639777 AGCCCCTTCCTCTGCAAAAAGGG - Intronic
1099376930 12:81903637-81903659 CTCCCGTTCCTGTAAAAAACCGG + Intergenic
1104626180 12:130357398-130357420 AACACCTTCCTGTGTAACACAGG - Intronic
1108046712 13:46390235-46390257 AACCAGTCTCTGTACAAAACAGG + Intronic
1108447861 13:50527244-50527266 CAACCCTTCCTGCACAGAACAGG - Intronic
1108890825 13:55256984-55257006 AACCAGTTCCTTTACAAATCTGG - Intergenic
1109329585 13:60911764-60911786 AACTCCTTCCTGTTGAAATCTGG + Intergenic
1110419565 13:75290806-75290828 AACCTCTTCCTCTACAAAATGGG - Intronic
1112471557 13:99694223-99694245 AACCAATTCCTGTAAAAACCTGG + Intronic
1114884999 14:26837967-26837989 AACCCATTTCTATACCAAACTGG + Intergenic
1120380611 14:83774425-83774447 AACCCCTTCTTTTATACAACTGG - Intergenic
1124352020 15:28962872-28962894 AACCGCTTCCTGGACAAGGCAGG + Intronic
1124580803 15:30953125-30953147 AACCCCTTCCTTTTCATAAAGGG - Intronic
1124600363 15:31128552-31128574 ACCCCCTTCCTGCTCACAACTGG + Intronic
1128430324 15:67587216-67587238 CACCCCTCCCTGTGCCAAACTGG - Intronic
1130105966 15:80928718-80928740 ATCCCCTTCCTGTGCAGAACAGG + Intronic
1130564999 15:84986474-84986496 CCCACCTTCCTGCACAAAACTGG + Intronic
1131435636 15:92419373-92419395 GACCCTCTCCTGTAGAAAACAGG - Intronic
1133443417 16:5839478-5839500 AAGCCCTTCCAGTACAACTCAGG + Intergenic
1135277271 16:21124279-21124301 AACCCCTTCTTGTAAAAGAGAGG + Intronic
1135615706 16:23909002-23909024 AACCCCTGCCTTCACAAAGCTGG - Intronic
1137569407 16:49555471-49555493 AACCCTTTCGTCTACAAAATGGG - Intronic
1138760091 16:59533275-59533297 AACCCCCACCCCTACAAAACTGG + Intergenic
1139741788 16:69041536-69041558 AGTCCCTGCCTGTACAAAAATGG - Intronic
1140688910 16:77462553-77462575 CACCCCTTCCTGCCCCAAACAGG - Intergenic
1140777643 16:78264712-78264734 AACCCCTACATTCACAAAACGGG + Intronic
1144077829 17:11734754-11734776 AATCCCATCCTGTACAAACCAGG + Intronic
1146650449 17:34603051-34603073 ACCCCCTTCCTGTGTAAGACAGG - Intronic
1148325005 17:46778223-46778245 AGCCCCTTCCTATCCAACACTGG + Intronic
1149544118 17:57490514-57490536 AAGCCCTTCCTGGACAACAGAGG - Intronic
1150979659 17:70127042-70127064 AACCCCTTTCTATAGTAAACTGG + Intronic
1156100892 18:33593480-33593502 AACCCCTTCATGTAGGAAAAGGG + Intronic
1158878539 18:61754649-61754671 AACCTCTTCCTCTACAAACAAGG - Intergenic
1162313269 19:9920267-9920289 AGACCCTGCCTGTACAAAAGGGG + Intronic
1165763267 19:38335150-38335172 AGCACCGTCCTCTACAAAACAGG - Intergenic
1166302272 19:41918033-41918055 AACCCCCTCCTCTCCAAGACAGG - Intronic
927527906 2:23764526-23764548 AACCCCATCTGGTATAAAACAGG - Intronic
933344093 2:81061347-81061369 AACTCCTTTCTGTAAGAAACAGG + Intergenic
934687155 2:96329650-96329672 AATCCTTTCCTATACAAACCTGG - Exonic
938963370 2:136362805-136362827 AACACCTTCCTCTACAAATGGGG + Intergenic
944920370 2:204406530-204406552 CATCCCTTCCTGTGGAAAACAGG + Intergenic
946016366 2:216607142-216607164 ATCTCATTCCTGTACAATACGGG + Intergenic
947542086 2:230986496-230986518 AAGCCTCTCCTGTATAAAACTGG + Intergenic
948422793 2:237870890-237870912 AACCCCATCCAGCACAAAGCAGG + Intronic
1173119590 20:40276513-40276535 AATCCCTTCCTGTTCCAAACTGG - Intergenic
1175044971 20:56096351-56096373 AACCTCTTCCTGTATGAAAGAGG - Intergenic
1175510107 20:59518405-59518427 AACTCCTTCCTGCACAGAAAAGG + Intergenic
1180626521 22:17197443-17197465 AACCCTTGTCTCTACAAAACAGG - Intronic
1182339081 22:29604946-29604968 AACCCATTCCTCTGTAAAACTGG + Intronic
1184546719 22:45174932-45174954 AACCCCTTCATTTACTAAATGGG - Intronic
952538962 3:34345918-34345940 TACACCTACATGTACAAAACAGG - Intergenic
954258994 3:49425280-49425302 GACCCCTTCCTGTAAAATTCTGG - Intronic
955996061 3:64682077-64682099 AACCCTTTCCTTTGCAAAATAGG + Intronic
958645297 3:96864079-96864101 TTCCCATTCCTGTACAAACCAGG - Intronic
958795351 3:98701309-98701331 GACCACTTCCTGTATAAAGCTGG + Intergenic
959024577 3:101225920-101225942 AACTCCTGCTTATACAAAACAGG - Exonic
960525185 3:118701643-118701665 AACCACTCCCTGTACAAGACTGG + Intergenic
963035806 3:141027718-141027740 AACCCTTTCTTGTGGAAAACTGG - Intergenic
964216819 3:154294411-154294433 TATCCCTTCATTTACAAAACTGG + Intronic
966697636 3:182808308-182808330 AACCAATTCCTTTACAACACTGG - Intronic
967305701 3:188057057-188057079 CACCCTTTCCAGTACAAACCAGG + Intergenic
970083326 4:12315622-12315644 ACCCCTTTCCTGTAACAAACAGG + Intergenic
970376837 4:15467344-15467366 TACCTCTACCTGCACAAAACTGG - Intergenic
974400679 4:61402236-61402258 AACCCCTTCCTGTACAAAACAGG - Intronic
976210234 4:82661114-82661136 AAACCCTTGCTGAACAAACCTGG - Intronic
976970291 4:91094866-91094888 CACCATTTCCTTTACAAAACAGG - Intronic
977463878 4:97358939-97358961 AAACCTTTCATGTCCAAAACTGG + Intronic
979178247 4:117692110-117692132 CACCCCTTCCTTCACAAGACTGG + Intergenic
984487856 4:180394933-180394955 AATCTCCTCCTGTGCAAAACAGG - Intergenic
1000971933 5:167724350-167724372 AATCTCTTCATGTATAAAACAGG + Intronic
1002408271 5:179053402-179053424 CACCATTTCCTTTACAAAACAGG + Intergenic
1008508338 6:52252974-52252996 AACCTCTTTATATACAAAACAGG + Intergenic
1008764073 6:54889474-54889496 CACCCCTTCCTGTACCAATGCGG + Intronic
1008831061 6:55762714-55762736 AACTCCTTGATATACAAAACGGG + Intronic
1018816065 6:167332222-167332244 AACCCCGTGCTGTAACAAACAGG - Intronic
1020144210 7:5630333-5630355 AACCCACTCCTTTCCAAAACAGG + Intronic
1026482765 7:70792920-70792942 AAGCCATACCTGTACAAGACCGG + Exonic
1028329591 7:89572767-89572789 AACACCTTCCTGAACTAAAAAGG - Intergenic
1031087869 7:117321841-117321863 AACGCCTCCCTGTTCAAAGCCGG + Intronic
1031748552 7:125538963-125538985 AAGACCTTCCTGTACAACATGGG + Intergenic
1033021680 7:137731580-137731602 AACCCTTTCCTCTTCAAATCAGG + Intronic
1033516536 7:142112191-142112213 AAACCCTTCCTGCCCAAAGCTGG - Intronic
1037144401 8:15555492-15555514 AAGGCCATCCTGTACAACACAGG - Intronic
1039635499 8:39160054-39160076 AATCCCTGCCTGTACACATCTGG - Intronic
1039785200 8:40828746-40828768 AAAGCCCTCATGTACAAAACAGG - Intronic
1041593092 8:59613594-59613616 AACCCCTACCTGTATAACAGTGG - Intergenic
1046365365 8:113223080-113223102 AACAACTTCCTTTACTAAACAGG + Intronic
1046769926 8:118108812-118108834 TACCCCTTCCTGTTCCAATCAGG + Intronic
1051731113 9:20143991-20144013 AATCTCTTCCTCTACAAGACAGG + Intergenic
1057889169 9:98855149-98855171 AACACCTTCCCATTCAAAACAGG - Intergenic
1058783214 9:108360410-108360432 AATCCCTTCCTTTACAAATGAGG + Intergenic
1059701145 9:116776235-116776257 AAACCCTTCCTTTACAAAAGAGG - Intronic
1061784246 9:133016298-133016320 TAAACCTTGCTGTACAAAACTGG + Intergenic
1185906538 X:3939005-3939027 ACCTCCTTCTTGTACAGAACGGG - Intergenic
1188016836 X:25115524-25115546 AACACCTTCCTGTAAAGAAGAGG - Intergenic
1188374192 X:29407229-29407251 AACCCCTTCCTCTCCACTACTGG + Intronic
1189747519 X:44184749-44184771 GACCCCTTCCTCTACAACTCTGG + Intronic
1189959577 X:46311631-46311653 AAGCCCATCCTTTATAAAACCGG - Intergenic
1191036309 X:56029294-56029316 CACCATTTCCTTTACAAAACAGG - Intergenic
1198019356 X:132643227-132643249 AACCTCATCTTGTGCAAAACGGG + Intronic
1198155180 X:133952698-133952720 AACTCATTCCTGGAGAAAACTGG + Intronic
1198187027 X:134263522-134263544 GACCCCTCCCTCTCCAAAACTGG + Intergenic
1198969804 X:142268075-142268097 CACCATTTCCTTTACAAAACAGG + Intergenic
1201362439 Y:13167638-13167660 AGCCCCTTCCTTCATAAAACTGG - Intergenic
1201680784 Y:16641910-16641932 CACCACTTCCTTTACAAACCAGG - Intergenic