ID: 974402619

View in Genome Browser
Species Human (GRCh38)
Location 4:61425712-61425734
Sequence GGGAAGGAACCCTCCTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 1, 2: 7, 3: 28, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974402619_974402630 11 Left 974402619 4:61425712-61425734 CCCACAGAGGAGGGTTCCTTCCC 0: 1
1: 1
2: 7
3: 28
4: 214
Right 974402630 4:61425746-61425768 CTATGAACAGTCATTCACGGAGG 0: 1
1: 0
2: 1
3: 10
4: 62
974402619_974402627 8 Left 974402619 4:61425712-61425734 CCCACAGAGGAGGGTTCCTTCCC 0: 1
1: 1
2: 7
3: 28
4: 214
Right 974402627 4:61425743-61425765 CCCCTATGAACAGTCATTCACGG 0: 1
1: 0
2: 2
3: 8
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974402619 Original CRISPR GGGAAGGAACCCTCCTCTGT GGG (reversed) Intronic