ID: 974406902

View in Genome Browser
Species Human (GRCh38)
Location 4:61484397-61484419
Sequence TTAGGTCATCACTGCTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974406898_974406902 -2 Left 974406898 4:61484376-61484398 CCTACCTAATACTTTCCTTAGTT 0: 1
1: 0
2: 1
3: 20
4: 261
Right 974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG No data
974406897_974406902 -1 Left 974406897 4:61484375-61484397 CCCTACCTAATACTTTCCTTAGT 0: 1
1: 0
2: 3
3: 14
4: 171
Right 974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG No data
974406896_974406902 22 Left 974406896 4:61484352-61484374 CCTGGAAGTTGGAATGTCAATAT 0: 1
1: 0
2: 3
3: 15
4: 151
Right 974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG No data
974406900_974406902 -6 Left 974406900 4:61484380-61484402 CCTAATACTTTCCTTAGTTAGGT 0: 1
1: 0
2: 1
3: 11
4: 129
Right 974406902 4:61484397-61484419 TTAGGTCATCACTGCTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974406902 Original CRISPR TTAGGTCATCACTGCTTTAT TGG Intronic
No off target data available for this crispr