ID: 974407308

View in Genome Browser
Species Human (GRCh38)
Location 4:61490776-61490798
Sequence GGAGAAACTCTATGAATAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974407304_974407308 13 Left 974407304 4:61490740-61490762 CCTTGGTTTTCAGAAACTCTGAA 0: 1
1: 0
2: 1
3: 18
4: 319
Right 974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG 0: 1
1: 0
2: 1
3: 17
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974407308 Original CRISPR GGAGAAACTCTATGAATAAT GGG Intronic
900665992 1:3815851-3815873 GGTGAAACCCTATAAAAAATTGG - Intronic
905657659 1:39695590-39695612 GGAGAAGCCATATGTATAATGGG + Intronic
906030106 1:42712422-42712444 TGAGAAACTTTATGAATACATGG - Intergenic
906181567 1:43824653-43824675 GGAGAAAGTCTTTGAACAGTGGG - Intronic
906789738 1:48648384-48648406 GGAGAGGCTCTATCAAGAATGGG - Intronic
907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG + Intergenic
907905388 1:58780063-58780085 GGAGAAACTCTTTGTGTATTTGG + Intergenic
908035698 1:60050041-60050063 AGAGCAGCACTATGAATAATGGG - Intronic
908064383 1:60386760-60386782 GGAGATAGGCTATGCATAATGGG + Intergenic
908650730 1:66329927-66329949 GGAGATACTCAGTAAATAATTGG - Intronic
909224533 1:73000928-73000950 GGAGATACACTATGAATTTTGGG + Intergenic
914228140 1:145739261-145739283 GGAGGAACTACATGAATAAAGGG + Exonic
916457799 1:164988793-164988815 GGACACTCTATATGAATAATTGG - Intergenic
917901820 1:179550433-179550455 GGAGAATCACTATAAATAGTGGG - Intronic
918910725 1:190564994-190565016 TGAGAAAATCTATAAATAAGTGG + Intergenic
919469422 1:197959871-197959893 GGAGAAACTCTATTATTATAAGG + Intergenic
920816280 1:209335945-209335967 GGACACACTTTATGAATAACAGG - Intergenic
920998690 1:211019854-211019876 TGGGAAACTTTATGAATACTTGG + Intronic
921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG + Intergenic
922651566 1:227344162-227344184 GGAAGAACTCCGTGAATAATAGG + Intergenic
922941925 1:229474424-229474446 AGAGAGACTCAATGAATGATTGG + Intronic
924080374 1:240390053-240390075 GGAAAAACTTTCTGAAAAATTGG - Intronic
924197227 1:241620868-241620890 AGAGAAACTCTGTGCATATTGGG + Intronic
924690475 1:246345150-246345172 GGAGAAACTCTTTGGATATGGGG - Intronic
1065271637 10:24039133-24039155 GGAGAACCTCTAAAAAAAATTGG - Intronic
1065290725 10:24226968-24226990 GTAGAAATTCTGTGAATAACTGG - Intronic
1066749855 10:38643518-38643540 GGAGAATCTCCTTGAATAACAGG + Intergenic
1066966787 10:42274202-42274224 GGAGAATCTCCTTGAATAACAGG - Intergenic
1067692327 10:48509717-48509739 GGAGAGGCTCTCTGAATAAAGGG + Intronic
1068341214 10:55705530-55705552 GGAGAAAATGTATGAGTGATTGG + Intergenic
1068731902 10:60367524-60367546 GGAGAAAAGCTTTTAATAATGGG - Intronic
1069837066 10:71316070-71316092 GGAGAAGCTCTAAGAACAAAAGG + Intergenic
1071128008 10:82358233-82358255 GGAGAAAGTGAAAGAATAATTGG + Intronic
1071270882 10:84006314-84006336 GTAGAAACCCTGTGAAAAATGGG - Intergenic
1072219131 10:93312937-93312959 GGAGTAAGTCTATGGATAAAGGG + Intronic
1074052175 10:109889949-109889971 GGAGAAACTGTATTAATAAGTGG - Intronic
1074916527 10:117961404-117961426 GGAGACAGACTGTGAATAATGGG + Intergenic
1077665505 11:4104953-4104975 GGAGAATCTGAATGAAAAATGGG + Intronic
1079757086 11:24278130-24278152 TGAGCAAATCTATGAATTATTGG + Intergenic
1079814427 11:25038140-25038162 GGACAAAATCTATGACTCATTGG - Intronic
1079949238 11:26781281-26781303 GGAAAAACTCTACAAATAGTGGG - Intergenic
1080305616 11:30831684-30831706 GGAGAATCCCTAGGAATATTGGG + Intronic
1080354562 11:31427352-31427374 GTAGAAATTCAGTGAATAATTGG + Intronic
1081078028 11:38699937-38699959 GGAGAAACTCCCTGCATACTGGG - Intergenic
1081621071 11:44619449-44619471 GGGGCAACTGTATGAAAAATTGG + Exonic
1092455418 12:8638385-8638407 GGAGAAAGTCCATAAATAAGGGG + Intronic
1092519803 12:9258068-9258090 GGAGAAAGTCTATGAAAAAAAGG + Intergenic
1093346925 12:18049373-18049395 GGAGTTACTCTATGAATGAAAGG + Intergenic
1095192336 12:39271951-39271973 GGAGACAACCTAGGAATAATGGG - Intergenic
1096925225 12:55136520-55136542 GGACCAACTCTATGACTCATTGG + Intergenic
1100742851 12:97614339-97614361 GGAGAAACGATATGATTCATCGG + Intergenic
1103748910 12:123145551-123145573 GGAAAAGCTTTATGAAGAATGGG + Intronic
1106389011 13:29317269-29317291 GGAGAAACAATCTGAATACTGGG - Intronic
1109357164 13:61246277-61246299 AGACAAAATCTATGAATCATTGG - Intergenic
1109469260 13:62783481-62783503 GTTTAAACTCTATTAATAATAGG - Intergenic
1110154082 13:72292619-72292641 AGAGAAAATATATGAATAAAGGG + Intergenic
1110889638 13:80682295-80682317 GGTGTAACTCTAAGAATAAGAGG - Intergenic
1110942805 13:81371007-81371029 GGAGAAAGTAGAGGAATAATTGG - Intergenic
1110981312 13:81902353-81902375 GGAGAAACTCAATGGGTAGTGGG + Intergenic
1111394672 13:87649714-87649736 GGCGAAACTTTATGAAGAAAAGG - Intergenic
1115701369 14:35956353-35956375 GGTGTAACTCTAAGAAAAATTGG + Intergenic
1116525240 14:45896136-45896158 GAAGAAGCTCTATGATTTATAGG + Intergenic
1117834611 14:59790440-59790462 GGAGAAAAATTATGAATAAAAGG - Intronic
1117993778 14:61459671-61459693 GGAGAAAGGATATGAATATTTGG - Intronic
1119109727 14:71960218-71960240 GGGGATGCTCTATGCATAATAGG - Intronic
1120568522 14:86089431-86089453 GAAGAAAATCAATGTATAATTGG + Intergenic
1121583822 14:95049314-95049336 GGAGGAACTCTCTGACTAAGGGG - Intergenic
1122104566 14:99442481-99442503 GAAGAAAATCTATGTATAAGTGG - Intronic
1126689008 15:51273272-51273294 AGAGAAACTATATGATCAATAGG + Intronic
1127131790 15:55873233-55873255 GCAGAATCTCTGAGAATAATGGG - Intronic
1128616562 15:69115017-69115039 GGAGAATCTCCATGAATTATTGG + Intergenic
1129421264 15:75428809-75428831 GGAGAAAATCCATGTATAAGTGG - Intronic
1130330296 15:82917196-82917218 GGGCAAACTCTTTCAATAATGGG - Intronic
1130713418 15:86307293-86307315 TGAGGAACTCTTTGAATATTAGG + Intronic
1131336479 15:91553911-91553933 GGAGAGACACTATGACTAAAAGG - Intergenic
1133610432 16:7428203-7428225 GGAGAAACTAAATGAATAAAAGG - Intronic
1136901418 16:34042532-34042554 GTAAAAACTTTATGCATAATGGG - Intergenic
1139165666 16:64562514-64562536 GGAGAAACTCTTGGTATGATAGG + Intergenic
1141333460 16:83133475-83133497 GGAGAGACTGTATCAAAAATAGG - Intronic
1144162451 17:12573521-12573543 GAAGAAACTTTTTAAATAATTGG - Intergenic
1144291947 17:13834925-13834947 GAAGAAAATCTGTGTATAATTGG - Intergenic
1144343446 17:14330226-14330248 GTAGAACCTCTATAAATATTTGG - Intronic
1146989829 17:37259696-37259718 TGAAAAACTCAATGAAAAATCGG + Intronic
1149076611 17:52602912-52602934 AGCGAAATGCTATGAATAATAGG + Intergenic
1149389354 17:56173829-56173851 GAAGATACTCTATAAATATTTGG + Intronic
1150150739 17:62807476-62807498 GGAGAAACTCAACGTGTAATTGG + Intronic
1153337403 18:3938779-3938801 AGAGATGCTCTAAGAATAATGGG + Intronic
1157517105 18:48318750-48318772 GGAGAGACTCTTTGAATATTAGG - Intronic
1162265113 19:9566587-9566609 GGAGAAACCCTATGAATGTAAGG - Exonic
1162270427 19:9610220-9610242 GGAGAAACCCTATGAATGCAAGG - Exonic
1162280185 19:9690158-9690180 GGAGGAACCCTATGAATATAAGG - Exonic
1162283925 19:9723670-9723692 GGAGAAACCCTATGAATATAAGG - Intergenic
1164278326 19:23744610-23744632 AGAGAAACTCAATGAATATAAGG - Exonic
1164962705 19:32448734-32448756 GAAGAAAATCTATGTATAATTGG + Intronic
1165298018 19:34944238-34944260 GGAGAAACCCTATGAATGTAAGG + Exonic
1165536275 19:36449039-36449061 TGAGAAACCCTATGAATATAGGG - Exonic
1165684161 19:37803773-37803795 GGAGAAACCCTATGAATGTAAGG + Intronic
1165848797 19:38836936-38836958 GGAGAAACGCCGTGCATAATTGG - Intronic
1166024934 19:40074089-40074111 TGAGAAACTCTATGAATGTAAGG - Exonic
1166578787 19:43872887-43872909 GGAGAAACCCTATGAATGTAAGG - Exonic
1168633909 19:57979719-57979741 AGAAAAACTCTATGAATATAAGG - Exonic
926666207 2:15526278-15526300 GGATAAGCTCTATGAATATGTGG - Intronic
930345190 2:50171177-50171199 GAAGAAACTCTATGTATAAGTGG + Intronic
930766504 2:55090713-55090735 GGAGAAATTGTATGAGCAATTGG - Intronic
932013594 2:68001577-68001599 GGAGAAACACTATGATCATTTGG - Intergenic
934312850 2:91885694-91885716 GGAGAATCTCCTTGAATAACAGG + Intergenic
936170382 2:110166649-110166671 GGAGAAAAGCAATCAATAATTGG - Intronic
936246430 2:110832173-110832195 GGAGAAACTCTTTGAGGTATAGG + Intronic
940208014 2:151225608-151225630 GGAGAAACACAAGCAATAATTGG + Intergenic
940428847 2:153563735-153563757 GGAAAACTTCTATGAATAAATGG - Intergenic
941196993 2:162465043-162465065 GGGGAAAGTCTAGGAATAAAAGG + Intronic
944952886 2:204772932-204772954 GGAGAAAATTTATAAAGAATAGG - Intronic
945781260 2:214175352-214175374 AGAGAAATTCTGTGAATAAAAGG + Intronic
945922951 2:215774483-215774505 GGAAAAAGTCTAGGAATTATGGG - Intergenic
946036602 2:216747325-216747347 CGAGCAACTCTAAGAATTATCGG + Intergenic
946069778 2:217024169-217024191 GTAGGCACTCTATGAACAATGGG - Intergenic
1168738240 20:163258-163280 GGAGTATCTGTATGAATTATTGG - Intergenic
1170114963 20:12847594-12847616 TGAGAAAATCTAGGAATTATAGG + Intergenic
1170419320 20:16176877-16176899 GAAGAAAATCTATGAATATGTGG - Intergenic
1171378510 20:24713791-24713813 GGACAAAACCTAAGAATAATTGG - Intergenic
1172015827 20:31872190-31872212 GGAGAACCTCTCTGAATAAGTGG + Intronic
1173095174 20:40020091-40020113 GGAGATGGTCTATGAATGATTGG - Intergenic
1174822165 20:53736110-53736132 GGGGAAAATCAATAAATAATGGG - Intergenic
1177366714 21:20149160-20149182 GGAGAAAATCTGTGTATAAGTGG + Intergenic
950073826 3:10172975-10172997 GGCCAAACTCTATGAAAAACAGG + Intronic
950571779 3:13804859-13804881 GAAGAAACTCTGAGGATAATTGG - Intergenic
951384303 3:22025913-22025935 GTAAATACTATATGAATAATTGG + Intronic
952388173 3:32858131-32858153 GAAGAAAATCTATGTATAAGTGG + Intronic
952761178 3:36915540-36915562 GTAGATGCTATATGAATAATAGG - Intronic
953005962 3:38979659-38979681 GGAGAAACACTATGCAGACTTGG - Intergenic
953168646 3:40487782-40487804 GGAGAAACCCTATGAATGCCAGG + Exonic
955049564 3:55396822-55396844 GGAGAAATGCTAAGAACAATGGG + Intergenic
955361465 3:58279655-58279677 GAAGAAACTGCATCAATAATGGG - Intronic
955615759 3:60805007-60805029 GTAGATACTCAATGAATATTTGG + Intronic
957238698 3:77629037-77629059 GGGAAAACTTCATGAATAATTGG + Intronic
957294200 3:78315330-78315352 GGATAAACTCTATCATTTATTGG + Intergenic
957389522 3:79545937-79545959 GAAGAAACTCTGTGAATAAGTGG - Intronic
958458363 3:94362075-94362097 GAAGAAAGTATATGAGTAATTGG - Intergenic
959478547 3:106842359-106842381 GGAGAAACCCCATGAGCAATGGG - Intergenic
959650077 3:108743027-108743049 GTAGAATGTCTATGAATCATGGG + Intergenic
960330602 3:116355738-116355760 GGAAAAAATCTAATAATAATGGG + Intronic
962150272 3:132885473-132885495 GGAGAAACTCTCTGGAACATTGG + Intergenic
963405872 3:144863170-144863192 GGAGAAAATCCATGTATGATTGG - Intergenic
964653548 3:159040634-159040656 TGAGAAACTCTCTGAGTGATGGG + Intronic
965810318 3:172585009-172585031 AGAGAAACTCTATGTATTTTTGG + Intergenic
969334291 4:6498364-6498386 GGAGAAACTCAGAGAATAGTAGG + Intronic
970687267 4:18582849-18582871 GAAGAAAGCCTATGAATAATGGG + Intergenic
970810723 4:20090675-20090697 AGAGAAAGACTATGACTAATAGG + Intergenic
971440006 4:26674490-26674512 GGATAACTTCTATGATTAATGGG - Intronic
974407308 4:61490776-61490798 GGAGAAACTCTATGAATAATGGG + Intronic
976113510 4:81701874-81701896 AGAGAAAGTGTATGAATAAACGG - Intronic
976737573 4:88326173-88326195 GAAGAAAATCCATGTATAATTGG - Intergenic
977028725 4:91855199-91855221 GGAAAAACACTATCAATAATAGG + Intergenic
979895500 4:126150614-126150636 GAAGACACTCTATGAAAACTAGG - Intergenic
980764216 4:137278382-137278404 AGAGAAACTTGATGAATAATAGG + Intergenic
982779768 4:159478891-159478913 GGAGAAAGTTTATGGAAAATTGG + Intergenic
982837379 4:160137288-160137310 GGAGAAAATCTGTGTATAAGTGG + Intergenic
983714138 4:170756145-170756167 TGACAAATTCTATGAATTATTGG - Intergenic
984264114 4:177475777-177475799 GGAGAAAGAATATAAATAATAGG - Intergenic
984415642 4:179455541-179455563 TGAGAGAATCTATGAAGAATTGG + Intergenic
986931299 5:12825757-12825779 TGACAAAACCTATGAATAATAGG - Intergenic
990344527 5:54858452-54858474 GGAGAAACCCTATGAATGTAAGG + Intergenic
991031040 5:62082739-62082761 GGAGGAACTCTGTGACTATTGGG - Intergenic
991412146 5:66356168-66356190 GGGAAAATGCTATGAATAATGGG + Intergenic
992658472 5:78933993-78934015 GGAGAAAGTCAAAGAATAAGGGG + Intronic
993323107 5:86500169-86500191 GGAGCAACTGTAAGAAAAATGGG - Intergenic
994332965 5:98528822-98528844 CAAGGAACTCTATGAATAACTGG + Intergenic
994494206 5:100489003-100489025 GCAGAAATTCTATAAGTAATGGG - Intergenic
994787627 5:104184934-104184956 GCAGAAACTTTATCAATAAATGG + Intergenic
997102361 5:130982592-130982614 GGAGAAACACTCTGTCTAATTGG - Intergenic
1000664283 5:163975580-163975602 GAAGAAAATCCATGAATAAGTGG - Intergenic
1003605604 6:7557738-7557760 GGAAAAACTCTGTGCATAAGAGG + Intronic
1004860450 6:19799651-19799673 GGGGAAAGTATATGTATAATTGG - Intergenic
1009297160 6:61966004-61966026 GGAGGTACACTATGAATAATAGG - Intronic
1011709707 6:90039948-90039970 GGAGAAGCTCTTTAAATATTAGG + Intronic
1012118955 6:95339795-95339817 AGAGAAAATCTATTAATAGTAGG + Intergenic
1013187253 6:107770553-107770575 AGAGAAACTCTATGAGGAAATGG + Intronic
1013331443 6:109105665-109105687 TCAGAAACTATATGAATCATAGG - Intronic
1014373952 6:120648580-120648602 TGAGATAATATATGAATAATAGG - Intergenic
1015443434 6:133274039-133274061 TGAAAAACTCTAAGAAAAATAGG - Intronic
1016642492 6:146365466-146365488 GGAGAAATGCTGTGAATCATGGG + Intronic
1016786738 6:148018934-148018956 GAACAAATTCCATGAATAATAGG - Intergenic
1017245610 6:152221475-152221497 GGTGACACTCTTTTAATAATTGG + Exonic
1017299931 6:152845201-152845223 ATAGATACTCAATGAATAATTGG - Intergenic
1017556751 6:155579950-155579972 GAAGAACCACTATGAATGATAGG + Intergenic
1020029481 7:4922774-4922796 AGAGGAACTCAATGAATACTAGG - Intronic
1020483363 7:8690294-8690316 GCAGAAAGTCTATTAATAAATGG + Intronic
1020845911 7:13283353-13283375 GAAGAATCTCTATGAATAGATGG + Intergenic
1021079664 7:16348819-16348841 GGATAAACTCTAAGAAGAGTGGG - Intronic
1021596363 7:22321264-22321286 GGAGTAACTCCAGAAATAATTGG + Intronic
1021782750 7:24122096-24122118 GGAAGAACTCAAAGAATAATGGG - Intergenic
1023291864 7:38676860-38676882 AGATAAACTCTTTAAATAATAGG + Intergenic
1029108697 7:98199473-98199495 GGAGCAGCTCTATGAATATAAGG - Intronic
1032730628 7:134638715-134638737 GGAGGAATTCAATGAATAATTGG + Intergenic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1038365492 8:26927827-26927849 TGGGAAACTTTATGATTAATGGG + Intergenic
1038508162 8:28104262-28104284 GGAGAAAATATCTGCATAATTGG - Intronic
1039448989 8:37656441-37656463 GTAGAAATTCTATAAATATTTGG - Intergenic
1041052247 8:53946554-53946576 GAAGAAATTCTATTAATACTTGG + Intronic
1041426856 8:57730986-57731008 TGAGAAACTATATGAATCAGTGG + Intergenic
1042724195 8:71854684-71854706 AGAGAAACACAATGAATAAGGGG - Intronic
1043257838 8:78158107-78158129 GCGAAAACTCTATGAATTATTGG - Intergenic
1044421693 8:92003577-92003599 GGAGAGACTCGATGGAAAATTGG - Intronic
1046434703 8:114172395-114172417 GGAGAAGCTGTGTGAAGAATTGG - Intergenic
1047582784 8:126235131-126235153 GGAGAACCACTAGAAATAATTGG + Intergenic
1047806561 8:128367104-128367126 CAAGAAGCTCTATGGATAATAGG - Intergenic
1048162552 8:132034518-132034540 GGAGGAACTTTCTGAATTATTGG + Intronic
1048283018 8:133119233-133119255 GGAGAAAGCGGATGAATAATGGG - Intronic
1048753782 8:137711545-137711567 GGAGTAGCTATATGAATAACAGG - Intergenic
1049965823 9:778443-778465 TTAGAAACTCTATAAATAAATGG + Intergenic
1052501927 9:29302998-29303020 GGAGAATATCTAAGAATAAAGGG - Intergenic
1052600534 9:30623039-30623061 AGAGAAAATCAAGGAATAATAGG + Intergenic
1052609390 9:30752290-30752312 GCAGATAGTCTATGAATAAGTGG - Intergenic
1052962431 9:34310766-34310788 TGAGAGATTCTTTGAATAATGGG + Exonic
1056464680 9:86842196-86842218 GGAGAACATCTATGTATAAGTGG - Intergenic
1057850476 9:98563243-98563265 GGAGAACCTCTGTGAATCTTTGG - Intronic
1058248936 9:102668020-102668042 GGAGAACATCTAAGAATTATTGG - Intergenic
1059712083 9:116877815-116877837 GGAGAATTTCTATGACTAAATGG - Intronic
1062214184 9:135380215-135380237 GGAGAAACACAATGAATAGGCGG + Intergenic
1186288873 X:8074763-8074785 GAAGAAACTCTGTGTATAAGTGG - Intergenic
1186575588 X:10762177-10762199 AGAGAAAGTCTATTAATACTTGG + Intronic
1186749739 X:12609255-12609277 GAAGAAAATCTATGTATAAGTGG + Intronic
1186994654 X:15106944-15106966 GGAGCAAATCTAAGAATTATTGG - Intergenic
1187355541 X:18567021-18567043 TGAAAAAGTTTATGAATAATTGG - Intronic
1189879727 X:45477864-45477886 GGAGAAAGGATCTGAATAATGGG - Intergenic
1189899651 X:45692965-45692987 GCAGAAACTCTATGTATATGTGG - Intergenic
1192035805 X:67561738-67561760 GGAGATGCTCCATGAATACTGGG - Intronic
1192046679 X:67682680-67682702 GGAGAAATTGAATAAATAATAGG + Intronic
1194711999 X:97246247-97246269 GGAGAAACCTTTTGAATAATTGG + Intronic
1194723419 X:97367167-97367189 AGAAAAACTCTATAAATAATGGG + Intronic
1195374341 X:104211901-104211923 GCTGTAACTCTAGGAATAATGGG + Intergenic
1196554646 X:117072030-117072052 GGACCAAATCTATGACTAATTGG + Intergenic
1197037641 X:121895741-121895763 GGAGAAAATCCATGTATAAGTGG - Intergenic
1198409691 X:136354003-136354025 GCAGAAGCTCTTTGAAAAATAGG + Intronic
1198483245 X:137060447-137060469 GAAGAAAATCTATGTATAAGTGG - Intergenic
1198522973 X:137471459-137471481 GGAGAAATTCTGAGAATAGTTGG - Intergenic
1198670174 X:139071685-139071707 GGAGAAATTCTATGAATAACAGG - Intronic
1199306878 X:146277864-146277886 AGACAAAATCTATGAATCATTGG - Intergenic
1199481811 X:148305935-148305957 GAAGAAACTCCATGTATAAGTGG - Intergenic
1201888437 Y:18914310-18914332 GGAGAAACTCTCTCATAAATAGG + Intergenic