ID: 974409193

View in Genome Browser
Species Human (GRCh38)
Location 4:61517293-61517315
Sequence GTGCGCCCTGCGGTCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974409187_974409193 12 Left 974409187 4:61517258-61517280 CCTGAGGCGGGACTGAGGTGAGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409183_974409193 22 Left 974409183 4:61517248-61517270 CCAGGGCTCCCCTGAGGCGGGAC 0: 1
1: 1
2: 3
3: 19
4: 214
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409186_974409193 13 Left 974409186 4:61517257-61517279 CCCTGAGGCGGGACTGAGGTGAG 0: 1
1: 0
2: 3
3: 17
4: 211
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409179_974409193 28 Left 974409179 4:61517242-61517264 CCTCTACCAGGGCTCCCCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 219
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409185_974409193 14 Left 974409185 4:61517256-61517278 CCCCTGAGGCGGGACTGAGGTGA 0: 1
1: 0
2: 1
3: 13
4: 149
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974409193 Original CRISPR GTGCGCCCTGCGGTCCCCGC AGG Intronic
900156175 1:1204157-1204179 GTGCGTCCCAGGGTCCCCGCCGG - Intronic
900511250 1:3062137-3062159 GTGCCCCCTGCAGCCCCCACAGG - Intergenic
901018024 1:6242654-6242676 GCGGGCCCTGCGGTCCGGGCTGG + Intergenic
902870733 1:19312262-19312284 GCGGGGCCTGCGGTTCCCGCGGG + Intergenic
903132788 1:21290366-21290388 GTCCGCCCTGCTGTCGGCGCTGG - Exonic
903321640 1:22546884-22546906 GTGGGGCCTGGGGTCCCAGCAGG - Intergenic
904858446 1:33517359-33517381 GTGCGCCATGCTGTCACCTCCGG - Intronic
909548037 1:76868677-76868699 CAGCGCCCCGGGGTCCCCGCGGG + Exonic
910936470 1:92486850-92486872 GTGCGCCCACCGGTCCCGCCGGG - Intronic
913680355 1:121184179-121184201 GTGCCCCCCGCAGTCCCCTCAGG + Exonic
914032190 1:143971830-143971852 GTGCCCCCCGCAGTCCCCTCAGG + Exonic
914157255 1:145096137-145096159 GTGCCCCCCGCAGTCCCCTCAGG - Exonic
914875798 1:151511956-151511978 CTGCGTCCTGCGGTCTCAGCTGG + Intronic
915309921 1:155001768-155001790 GGGCGCCCTTCCCTCCCCGCGGG + Intergenic
917348877 1:174056641-174056663 GAGCGGCCAGCGGGCCCCGCCGG - Intergenic
920467667 1:206202714-206202736 GTGCCCCCCGCAGTCCCCTCAGG + Exonic
922239945 1:223748937-223748959 GTGCGTCCGGCGGTCCCGCCCGG + Intronic
1074996359 10:118760416-118760438 GAGCGGCCAGCGGGCCCCGCCGG - Intergenic
1075375566 10:121975338-121975360 GTGCACCCAGCGGTCCCCCCAGG - Intergenic
1076712759 10:132347674-132347696 GTGCGCCCGGTGGTGCCTGCGGG + Intronic
1076874103 10:133207579-133207601 GTGCGCCTGGTGGTCCCCGGAGG + Intronic
1076887533 10:133269529-133269551 CTGAGCCCAGCCGTCCCCGCAGG - Exonic
1077054041 11:581576-581598 GTCGGCCCTGCGGACCCGGCAGG + Exonic
1077105832 11:842326-842348 GTCCGCCCTGGGGTGCGCGCCGG - Intronic
1077138032 11:1011312-1011334 GAGCGTCCTGCCGGCCCCGCAGG + Exonic
1081712613 11:45227031-45227053 GTGCGAGCTGCGGTCCACGGCGG + Intronic
1084087763 11:66862411-66862433 GTGGGCCGTGCTGTCCCCTCAGG - Intronic
1084944937 11:72633302-72633324 GAGAGCCCTGAGGTCCCCACAGG - Intronic
1085416517 11:76322110-76322132 GGGTCCCCTGCGGTCCCCGGCGG + Intergenic
1091402256 12:188343-188365 GAGCGGCCTGCCGGCCCCGCCGG - Intergenic
1099989709 12:89709094-89709116 GTCCGCTCTCCGGTGCCCGCGGG - Intronic
1104021334 12:124994149-124994171 CTGCCGCCTGCGGCCCCCGCCGG + Intronic
1104720527 12:131042890-131042912 ATGCGCCCAGCTGTGCCCGCAGG - Intronic
1104842291 12:131830843-131830865 GTGCGCTCTTTTGTCCCCGCCGG - Intronic
1105243734 13:18629070-18629092 GTGCGCCCTTCGCTCCCTGCCGG + Intergenic
1106516914 13:30464555-30464577 GTGCGCCCGGCAGGCCCTGCAGG + Intronic
1113456217 13:110450616-110450638 GTGCTCTCTGGGGTCCACGCAGG + Intronic
1113660786 13:112105181-112105203 TTGTGCCCGGGGGTCCCCGCGGG + Intergenic
1117039876 14:51760073-51760095 GCGCTCCCCGCGGCCCCCGCTGG - Intergenic
1119192200 14:72690332-72690354 GTGATCCCTGTGGTCCCCTCAGG - Intronic
1120881315 14:89417075-89417097 GCGCGCCCGGCGGACGCCGCAGG - Intronic
1122321587 14:100858899-100858921 GTGGGCCTTGGGGTCCCCTCAGG + Intergenic
1122769174 14:104090205-104090227 ATGGGCCCTGCTGTCCCTGCTGG - Intronic
1128321958 15:66700978-66701000 CGGCGCCCCGCGGTCACCGCGGG + Intergenic
1128582734 15:68820398-68820420 GTGCGCCCGCCGGCCCCCGATGG + Intronic
1128594101 15:68929146-68929168 GCGCGGCCGGCCGTCCCCGCTGG - Intronic
1129997137 15:80016613-80016635 GAGCGGCCTGCGGGCCCCACTGG + Intergenic
1132009815 15:98266240-98266262 GTGCAGCGTGCGGTCACCGCAGG + Intergenic
1132553006 16:560918-560940 GGGCGCCCTGCGTTCCCGGGGGG + Intronic
1136003654 16:27314107-27314129 GTGGTCCCCGTGGTCCCCGCCGG - Intronic
1136717122 16:32289781-32289803 GAGTGCGCTGCAGTCCCCGCTGG - Intergenic
1136835496 16:33496035-33496057 GAGTGCGCTGCAGTCCCCGCTGG - Intergenic
1140891081 16:79285714-79285736 GTGAGTCCTGCGGTGCCCTCTGG - Intergenic
1141699703 16:85636732-85636754 GTGGTCCCGGCGGTCCCTGCTGG + Intronic
1203009307 16_KI270728v1_random:227997-228019 GAGTGCGCTGCAGTCCCCGCTGG + Intergenic
1203145673 16_KI270728v1_random:1796348-1796370 GAGTGCGCTGCAGTCCCCGCTGG - Intergenic
1146182930 17:30709049-30709071 GCGCGTCCTGCGGTGCCCACGGG + Intergenic
1146352848 17:32110639-32110661 GTGCCCGCTGCAGTTCCCGCTGG - Intergenic
1152284514 17:79404411-79404433 GTGTGGCCTGGGGTGCCCGCGGG - Intronic
1152375398 17:79916136-79916158 GTGAGACCTGCGGGCCCCTCTGG - Intergenic
1152801768 17:82334016-82334038 GTGCGGCGCGCGTTCCCCGCGGG + Intronic
1153219111 18:2846975-2846997 GTGCGCCCTGCGCTTCTCCCCGG - Intergenic
1154445208 18:14430815-14430837 GTGCGCCCTTCGCTCCCTGCCGG - Intergenic
1160453766 18:78981285-78981307 TGGCGCCCTGGGGGCCCCGCGGG - Intronic
1160518870 18:79493333-79493355 GGGCCCGCTGCGGTGCCCGCGGG + Intronic
1160584246 18:79903909-79903931 GTGGGCCCTGACCTCCCCGCGGG - Exonic
1160982730 19:1823701-1823723 GTGCTACCTGCGGGCCCAGCAGG - Exonic
1161056769 19:2194690-2194712 GTGCCCCCTGGAGTCCCCTCTGG + Intronic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161084478 19:2328477-2328499 ATGCGCTCTGCTTTCCCCGCAGG - Exonic
1162566340 19:11447315-11447337 GTCCTCCCTGCAGGCCCCGCAGG + Intronic
1162737255 19:12753565-12753587 GTGCCCCCTGAGGTGCCCCCAGG + Intronic
1162737798 19:12756077-12756099 GTCCACCCTGTGGTCCCGGCGGG + Intronic
1162975880 19:14206756-14206778 GCGCGTCCTGCGGTGCCCACGGG - Intergenic
1168156230 19:54474252-54474274 GTTCCCACTGGGGTCCCCGCAGG + Intergenic
926718626 2:15942707-15942729 GCGGGCCCTGCGGTCGCCTCGGG + Exonic
928606368 2:32947649-32947671 GCGCGTCCCGCGGTCCCCGGCGG + Exonic
929775764 2:44929664-44929686 GTGCTCCCCTCGGTCCCCGCAGG + Intergenic
930785650 2:55269249-55269271 GTCCCCGCTACGGTCCCCGCCGG + Intronic
937227940 2:120380456-120380478 GTGCACCCTGGGGGCCCTGCAGG - Intergenic
942251028 2:174047896-174047918 GTGAGCCCTGGGGTCCCCGCAGG - Intergenic
1169327423 20:4686897-4686919 CCGCGCCCTGCGGAGCCCGCTGG - Intronic
1176060002 20:63168365-63168387 ATGCTTCCTGCTGTCCCCGCCGG - Intergenic
1182380584 22:29883737-29883759 GTGCGCCCTTCGCCCCCTGCCGG + Intronic
950282296 3:11719164-11719186 TGGCACCCCGCGGTCCCCGCCGG - Intronic
962259669 3:133894901-133894923 GTGTTCCCTGCGGACCCTGCTGG - Intronic
964198144 3:154088104-154088126 GTGGGCTCGGCGGGCCCCGCTGG + Intergenic
968510484 4:993356-993378 GAGGGCCCTGCGGTCCTCGGTGG - Exonic
974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG + Intronic
976421047 4:84844480-84844502 GTGTGCCCTGCTGTCCCCCAAGG - Intronic
976846060 4:89490149-89490171 GAGCGGCCTGCCGGCCCCGCCGG + Intergenic
980930055 4:139176688-139176710 CCGCGCCCCGCGCTCCCCGCGGG + Intronic
984888707 4:184473390-184473412 GTGCGCCCCCGGGTCCCCGCAGG - Intronic
992894276 5:81233231-81233253 GTGCGCCCGGAGGTCTACGCTGG + Intergenic
993654321 5:90558869-90558891 GCGCTCCCGGCGGTCCCCGCCGG - Exonic
998130737 5:139649937-139649959 GCGCACCCCGCGCTCCCCGCCGG - Intronic
1007098676 6:39229699-39229721 GCACGCCCTGCGGTGCCCGAGGG + Intergenic
1016330499 6:142947465-142947487 GTGCTGCGCGCGGTCCCCGCTGG - Intergenic
1018947175 6:168356115-168356137 GTGCCCCCTGGTGTCCACGCAGG + Intergenic
1029270466 7:99374405-99374427 CTGCGCCCGGCAGTCCCCGGGGG + Intronic
1029494153 7:100888265-100888287 GTCCGCCCTGCAGTCCCCACAGG + Exonic
1033220456 7:139523828-139523850 GCGCGCCCTGCGGGCCCCCCAGG - Intergenic
1035129554 7:156640026-156640048 GTGAGCCCTGCGTGGCCCGCTGG - Exonic
1044820883 8:96154932-96154954 CAGTGCCCTGCGTTCCCCGCGGG + Intronic
1048981111 8:139703749-139703771 GTGCGCAGCGGGGTCCCCGCCGG + Intergenic
1056552071 9:87660219-87660241 GTGGGCCCGGCCTTCCCCGCAGG + Intronic
1057035859 9:91811288-91811310 GTGGGCCCTGCGCTCCCCCGTGG - Intronic
1057128180 9:92635375-92635397 ATGAGCCCTGCGGTCTGCGCCGG - Intronic
1060811789 9:126614419-126614441 GGGCGCGCTGCGGACCCCGCCGG - Intergenic
1060825086 9:126683208-126683230 GCGCGCTCTGCGGGCCTCGCGGG - Intronic
1061545116 9:131299896-131299918 CTGGGCCCTATGGTCCCCGCAGG + Intronic
1061808440 9:133149092-133149114 GCGCGGCCTCCGGTCCCCGCCGG + Intronic
1185461441 X:334459-334481 GAGTGCGCTGCGCTCCCCGCTGG - Exonic
1185483522 X:465594-465616 GTACGCCCTGTGTTCCCCGGCGG + Intergenic
1187257533 X:17656187-17656209 GTGCGCCCTGGGCGCGCCGCCGG - Intronic