ID: 974409193

View in Genome Browser
Species Human (GRCh38)
Location 4:61517293-61517315
Sequence GTGCGCCCTGCGGTCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974409186_974409193 13 Left 974409186 4:61517257-61517279 CCCTGAGGCGGGACTGAGGTGAG 0: 1
1: 0
2: 3
3: 17
4: 211
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409179_974409193 28 Left 974409179 4:61517242-61517264 CCTCTACCAGGGCTCCCCTGAGG 0: 1
1: 0
2: 1
3: 21
4: 219
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409185_974409193 14 Left 974409185 4:61517256-61517278 CCCCTGAGGCGGGACTGAGGTGA 0: 1
1: 0
2: 1
3: 13
4: 149
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409183_974409193 22 Left 974409183 4:61517248-61517270 CCAGGGCTCCCCTGAGGCGGGAC No data
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
974409187_974409193 12 Left 974409187 4:61517258-61517280 CCTGAGGCGGGACTGAGGTGAGC 0: 1
1: 0
2: 2
3: 11
4: 169
Right 974409193 4:61517293-61517315 GTGCGCCCTGCGGTCCCCGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974409193 Original CRISPR GTGCGCCCTGCGGTCCCCGC AGG Intronic