ID: 974412487

View in Genome Browser
Species Human (GRCh38)
Location 4:61560129-61560151
Sequence GTGCCATAATAGAAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974412487 Original CRISPR GTGCCATAATAGAAGTATGG AGG (reversed) Intronic
904512432 1:31023478-31023500 TTGCCATAATAGAAAGATGTGGG + Intronic
906442795 1:45864226-45864248 GTGCCCTTTTAGAAGTCTGGGGG + Intronic
909902477 1:81155248-81155270 CTGACTTAATAGAACTATGGTGG + Intergenic
910667528 1:89741228-89741250 GTGTCATAATTGAAGTAAAGTGG - Intronic
911056658 1:93714281-93714303 GTTCCATAATAAAAGTATGATGG - Intronic
911768784 1:101712711-101712733 GGGCAATAATTGAATTATGGGGG - Intergenic
913566534 1:120078346-120078368 TGGCAATAAAAGAAGTATGGAGG - Intergenic
913631597 1:120715198-120715220 TGGCAATAAAAGAAGTATGGAGG + Intergenic
914287292 1:146239058-146239080 TGGCAATAAAAGAAGTATGGAGG - Intergenic
914548324 1:148689800-148689822 TGGCAATAAAAGAAGTATGGAGG - Intergenic
914618357 1:149381908-149381930 TGGCAATAAAAGAAGTATGGAGG + Intergenic
915445315 1:155971183-155971205 GTGCCAGAATAGAAAAAAGGAGG - Intronic
917296533 1:173525176-173525198 GTTCCATAATAGAGATATGGAGG - Intronic
919214614 1:194535715-194535737 ATGTCATTATAGAAGTCTGGTGG - Intergenic
921890028 1:220344529-220344551 GTCCCATAAAAGCATTATGGAGG + Intergenic
922062055 1:222102238-222102260 GGGGCAGAATAGAGGTATGGGGG - Intergenic
922623072 1:227006330-227006352 GTGCCATAAAGGCAGCATGGTGG + Intronic
1064900145 10:20287199-20287221 ATGCCATAGAAGAGGTATGGGGG - Exonic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1067957892 10:50813336-50813358 CTGCCAAAATATAACTATGGAGG + Intronic
1069035581 10:63642764-63642786 GGGCCATAATGGTAGAATGGTGG + Intergenic
1070045432 10:72829961-72829983 GTGTCATTATAGAAGTAGGCGGG + Intronic
1073892401 10:108116085-108116107 GTCCCAAAATAAAAGGATGGAGG + Intergenic
1080447457 11:32350849-32350871 GTGCCATCAAAGAACTAAGGAGG + Intergenic
1083717861 11:64589289-64589311 GGACCATAATAGAAGAATGCAGG + Intergenic
1084586322 11:70064868-70064890 GGGCCATCACAGAAGAATGGGGG + Intergenic
1099039195 12:77629938-77629960 ATGCCATAATAGAAATTTTGAGG - Intergenic
1101333943 12:103779792-103779814 CTGCCATAAGAAAAGTTTGGTGG - Intronic
1102567092 12:113803830-113803852 GTGCCATGAGAGAAGGATGCTGG - Intergenic
1103357668 12:120333675-120333697 GTGCCATTATAGCAGTTAGGAGG - Intergenic
1106884483 13:34169255-34169277 TTGCCATTGTAGCAGTATGGTGG + Intergenic
1114842412 14:26280911-26280933 GTGCCATAATAGGAGTACAGGGG - Intergenic
1117481783 14:56153039-56153061 GTGCCATGATAGTAGGATAGTGG + Intronic
1127168241 15:56270509-56270531 GTGTCAAAATAAAAGGATGGAGG - Intronic
1128889143 15:71315342-71315364 GTGTCATAATAAAAGTGTGAAGG - Intronic
1130346746 15:83054408-83054430 GTGCCATAATATATGTAAAGGGG + Intronic
1137843577 16:51664771-51664793 GTGCGATAATTGAATCATGGGGG + Intergenic
1141773196 16:86103854-86103876 CTGACATAATAGAAGCAAGGTGG - Intergenic
1143876570 17:9995774-9995796 GTGCAATAATGTAAGTATGAAGG + Intronic
1148701522 17:49589844-49589866 GTTCCAGAAGAGAAGAATGGGGG + Intergenic
1149975993 17:61266960-61266982 GTGCTATAAAGAAAGTATGGAGG - Intronic
1150168000 17:62963376-62963398 TTGGCAGAATAGAAGGATGGTGG + Intergenic
1157124000 18:44937891-44937913 GTCCCATAGTTGAAGTGTGGAGG + Intronic
1157188576 18:45561188-45561210 GTGCCATAACAGCTGTAGGGAGG + Intronic
1160088520 18:75803188-75803210 GTGCCATGATAGAGGTGTTGTGG + Intergenic
1164902042 19:31936436-31936458 GTGCCATAAGAACTGTATGGGGG - Intergenic
1164903667 19:31949348-31949370 GTGCCTTAATAGAAATATCGGGG - Intergenic
1167062567 19:47158906-47158928 GTGACATATTAGGAGGATGGTGG + Intronic
925332399 2:3068749-3068771 CTGCCATGAAAGCAGTATGGCGG + Intergenic
939576614 2:143902813-143902835 GTGCAATAATATAAATCTGGAGG + Intergenic
1180979901 22:19873521-19873543 GTGCCACAGCAGAAGTGTGGAGG + Intergenic
951146267 3:19231212-19231234 GTGTTATCATAGAAGTATAGAGG - Intronic
952547889 3:34441342-34441364 GGGGCATAATAGAAAGATGGTGG - Intergenic
956814798 3:72898511-72898533 GTGCCTTCATAGAATTCTGGAGG + Intronic
959038980 3:101398641-101398663 TTTCCAAAATACAAGTATGGTGG + Intronic
965528432 3:169746485-169746507 GTCCCATGATAGAAGAATGAAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974412487 4:61560129-61560151 GTGCCATAATAGAAGTATGGAGG - Intronic
976512791 4:85930333-85930355 GTGCTATAAAAGAAGCAGGGGGG + Intronic
977618588 4:99110990-99111012 GTCCAATAATAGAAGCATGATGG + Intergenic
979984259 4:127295300-127295322 GGGGCATAATTGAATTATGGAGG - Intergenic
984234856 4:177143120-177143142 GTGCCACAAGAACAGTATGGAGG - Intergenic
984957836 4:185063385-185063407 GTTCCATAAGAGAAGAATGGAGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
989329464 5:40239357-40239379 GTTCCATATCACAAGTATGGTGG + Intergenic
990547412 5:56836752-56836774 GTCCCCTAAAAGAAGTATGCTGG - Intronic
990649059 5:57877824-57877846 GTGCCAAAATGGAGGCATGGAGG + Intergenic
991172498 5:63645149-63645171 GTGACATGATAGAGGCATGGAGG - Intergenic
991432817 5:66566316-66566338 GTGCTATGATAGAGGTATGCAGG + Intergenic
994386341 5:99137301-99137323 GTGCCAAAATAGAAATTAGGTGG - Intergenic
995313982 5:110746190-110746212 GAGCCATGAAAGAAATATGGTGG - Intronic
996353100 5:122567457-122567479 GTGTCAGAAAAGAAGTGTGGTGG - Intergenic
998093989 5:139387035-139387057 GTGCCAGAATTGAATTTTGGAGG + Intergenic
1007348658 6:41252066-41252088 GTGGCATTAGAGAAATATGGTGG + Intergenic
1010227422 6:73504096-73504118 GTGTAATAATAGAAGTATTGTGG - Intronic
1012672210 6:102068360-102068382 GTGCCATGGTAGAAGAATTGAGG + Exonic
1012700847 6:102454836-102454858 GTGCCTTAATGGAAGTCTGAAGG - Intergenic
1014125156 6:117768755-117768777 GTTCCTTTATAGAGGTATGGAGG - Intergenic
1014897074 6:126914746-126914768 CTGCCATCTTAGCAGTATGGAGG + Intergenic
1016237545 6:141886834-141886856 GTGCCATCAAAGCAGCATGGGGG - Intergenic
1021883007 7:25112004-25112026 GTACCATAAGAACAGTATGGGGG - Intergenic
1023721737 7:43102526-43102548 TAGCCATTATAGAAGAATGGAGG - Intergenic
1023740894 7:43279702-43279724 GTGCCATAAGAGAATCAAGGTGG - Intronic
1027675541 7:81153561-81153583 CAGCCATAAAAGAAGTCTGGGGG + Intergenic
1031245905 7:119311039-119311061 TTGCCATCATAAAAGTATTGAGG - Intergenic
1032580888 7:133102523-133102545 GTTCCATAATAGATTTAGGGTGG + Intergenic
1039895758 8:41715408-41715430 GTGCCATGATAAATGTATGAAGG + Intronic
1044836300 8:96298702-96298724 GTGACATAAATGGAGTATGGTGG - Intronic
1047242774 8:123108034-123108056 GTGCCATATTAAAGGTATAGAGG - Intronic
1047607201 8:126487432-126487454 CTGCCACAAGAAAAGTATGGGGG - Intergenic
1053108373 9:35434218-35434240 GTGCCAAAATATATGTATAGTGG - Intergenic
1056469970 9:86895638-86895660 GTGCCATCTTAGAAGCAAGGAGG + Intergenic
1058297707 9:103329263-103329285 CTTCCTTATTAGAAGTATGGAGG - Intergenic
1189123332 X:38418678-38418700 GTACCATAAGAACAGTATGGGGG - Intronic
1191186553 X:57619404-57619426 GTGCCAGAATAAAAATATGTGGG - Intergenic
1192852124 X:74968172-74968194 GTGCCATAATAGAAGTAAGGGGG + Intergenic
1195565715 X:106336865-106336887 GGGACATAATAAAAGTTTGGTGG - Intergenic
1198572107 X:137968483-137968505 GTGCCATAATAAAGGGATGTGGG - Intergenic
1201587660 Y:15579011-15579033 TTCCCATAATAGAAGGATGATGG - Intergenic