ID: 974417674

View in Genome Browser
Species Human (GRCh38)
Location 4:61631008-61631030
Sequence TAGCATAGCTCAACTTGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 56}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974417674 Original CRISPR TAGCATAGCTCAACTTGTGT TGG Intronic
905834126 1:41102346-41102368 TAGCTTTGCTCAACTTGGCTGGG + Intronic
907755522 1:57306935-57306957 TAGCAAAGGTGAGCTTGTGTAGG + Intronic
920904157 1:210144806-210144828 TTGGATATATCAACTTGTGTAGG + Intronic
1062931481 10:1355340-1355362 CAGCAGAGCTCAGCTTCTGTGGG - Intronic
1071443918 10:85728627-85728649 TGGCATAGCACAACATGTGCAGG - Intronic
1072647693 10:97270886-97270908 TAGCATAGCTTAAGTGGTGATGG - Intronic
1084281327 11:68096443-68096465 TAGGATATCCCAACTTGTCTGGG - Intronic
1089637113 11:119822079-119822101 TTGAACAGCTCAACATGTGTCGG - Intergenic
1090490135 11:127153355-127153377 CAGCATAGCTGAAATTATGTTGG - Intergenic
1097412182 12:59268530-59268552 TAGCAGAGCTCAAGCTCTGTGGG - Intergenic
1097524155 12:60709716-60709738 TATCATCACTTAACTTGTGTTGG + Intergenic
1107235503 13:38164443-38164465 TAGCATATCTCAAATTATGCTGG - Intergenic
1120710895 14:87792136-87792158 TTGCATAGGTCAACTTGGTTAGG - Intergenic
1122746153 14:103898341-103898363 GAACTTAGATCAACTTGTGTTGG + Intergenic
1133712486 16:8414742-8414764 TAGCAGAGCTTAACCTATGTCGG - Intergenic
1139081199 16:63523471-63523493 TACCATAGGTAAACTTGTTTAGG - Intergenic
1152175751 17:78786092-78786114 TAGGATAGCTGAACATGTGGAGG + Intergenic
1164936016 19:32213958-32213980 TAGCATAGCTAAAATGGTTTTGG + Intergenic
928873102 2:36005000-36005022 TAGGAATGCTCAACCTGTGTAGG - Intergenic
936488049 2:112943546-112943568 TGGCTTAGCCCAGCTTGTGTGGG - Intergenic
938657557 2:133449879-133449901 TTGCATAGCACAATTTTTGTGGG + Intronic
939325397 2:140681762-140681784 AAGCAAAGCTCATCTTTTGTTGG + Intronic
946661510 2:222005606-222005628 CTGCATAGCTCAACATGTTTGGG - Intergenic
1172497048 20:35394944-35394966 TAGCATGGCTCAACTCGGGGAGG + Intronic
1174501053 20:50984885-50984907 TTGCATATCTCTGCTTGTGTAGG - Intergenic
1179359458 21:40692102-40692124 TGGCATATCTCAAAATGTGTTGG - Intronic
1180562890 22:16635325-16635347 TTACATAGGTAAACTTGTGTCGG + Intergenic
1181676066 22:24454019-24454041 TAGCATGACTCAACTTTTTTTGG - Intergenic
949208537 3:1470361-1470383 TTACATAGGTAAACTTGTGTCGG + Intergenic
950203977 3:11063792-11063814 AATCATAGCTCATATTGTGTCGG + Intergenic
971916228 4:32873403-32873425 CAGCATTGCTCAACATGTGTTGG - Intergenic
974417674 4:61631008-61631030 TAGCATAGCTCAACTTGTGTTGG + Intronic
976384120 4:84435364-84435386 TAGCATGGCAAATCTTGTGTGGG - Intergenic
983696924 4:170543710-170543732 TTACATAGGTCAACTTTTGTTGG - Intergenic
986106890 5:4668160-4668182 TAGGATGGCTCAACTTGTTCAGG + Intergenic
986975718 5:13391115-13391137 TAGCAAAGCTTAACATGTTTTGG - Intergenic
993482123 5:88437020-88437042 TTCCATAGCTCAACTTCAGTAGG - Intergenic
997063158 5:130530907-130530929 TAGCCTAGCTCAACATGAGTAGG + Intergenic
997293564 5:132755120-132755142 TAGCTCAGCTCTACTTGTGCAGG - Intronic
1005902636 6:30230865-30230887 TAGCTTAGCGAAACTAGTGTTGG + Intergenic
1006149929 6:31981655-31981677 TAGTATAGTTCAATTTGTGTTGG + Intronic
1006156230 6:32014393-32014415 TAGTATAGTTCAATTTGTGTTGG + Intergenic
1015103128 6:129504770-129504792 TAGCGTATCTGAAATTGTGTTGG + Intronic
1018467534 6:164064076-164064098 TAGCATAGAACAACTTTTCTTGG - Intergenic
1021775347 7:24049193-24049215 TTACATAGGTAAACTTGTGTTGG - Intergenic
1026479816 7:70768036-70768058 TAGAATGGGTCAACTTTTGTAGG - Exonic
1033946825 7:146728909-146728931 TAGCATAGATCAACTGGCTTTGG + Intronic
1037110302 8:15157778-15157800 TAGCATAGTTCAGCTAGTGGAGG - Intronic
1039417995 8:37411944-37411966 AATGAGAGCTCAACTTGTGTGGG + Intergenic
1043335517 8:79171668-79171690 TAGCAAGGCTCACGTTGTGTAGG + Intergenic
1043796546 8:84549108-84549130 TAGCATAGCTGTATCTGTGTGGG - Intronic
1050694709 9:8265777-8265799 TAGAATAGCTCAATATATGTTGG - Intergenic
1054954846 9:70897891-70897913 TAGCAAGGCTCACGTTGTGTAGG + Intronic
1055344995 9:75326642-75326664 TAGCAGAGCTCAAGCTGTGCTGG + Intergenic
1059965051 9:119605646-119605668 TAGCATAGCTACACTCTTGTTGG - Intergenic
1189164431 X:38846708-38846730 TAGCATAGCTCATCTGTGGTGGG + Intergenic
1189490840 X:41470775-41470797 TAGCACATCTCAATTTGGGTTGG + Intronic
1194743666 X:97605414-97605436 TAGAATAGCTCATCATGGGTGGG + Intergenic
1200695912 Y:6359385-6359407 TAGCATAACTCAAATAGTGGAGG + Intergenic
1201023619 Y:9683606-9683628 TAGCATAACTCAAATAGTGGAGG + Intergenic
1201039365 Y:9815321-9815343 TAGCATAACTCAAATAGTGGAGG - Intergenic