ID: 974424433

View in Genome Browser
Species Human (GRCh38)
Location 4:61722875-61722897
Sequence TTAATAGTCCCAGAGTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974424433 Original CRISPR TTAATAGTCCCAGAGTTTGG AGG (reversed) Intronic
903709143 1:25309218-25309240 TTAAAAATCCCACAGTTTGTGGG - Intronic
903712923 1:25338854-25338876 CTAAAAGTCCCAGAGTTTGGAGG + Intronic
903717969 1:25383202-25383224 TTAAAAATCCCACAGTTTGTGGG + Intronic
905306591 1:37023377-37023399 TGCAGAGTCCCAGAGTGTGGGGG + Intronic
908005683 1:59725766-59725788 TTATTAGTTCCAGGATTTGGTGG + Intronic
909138201 1:71829110-71829132 TTAATAGTTCCTGAGTTTGCAGG + Intronic
910401265 1:86840407-86840429 TGAAAAGTCCCAGAGTTTTCTGG - Intergenic
911448345 1:98030445-98030467 TTAATAGGCCTATAGTTTGATGG - Intergenic
914505373 1:148284391-148284413 TTTATAGTTACAGGGTTTGGGGG + Intergenic
914507189 1:148299760-148299782 TTTATAGTTACAGGGTTTGGGGG - Intergenic
917763562 1:178192167-178192189 TTAATGCCCCCAGAGTTTCGTGG + Intronic
919143870 1:193608625-193608647 GTAATTGTCCCAAAGTTTTGGGG + Intergenic
921850892 1:219930629-219930651 TTAATAAGCTCTGAGTTTGGAGG - Intronic
922449096 1:225722364-225722386 TCAATAGTCCCACAGTTTTTTGG + Intergenic
922466501 1:225848614-225848636 TTAATAGTCTGTGTGTTTGGAGG - Intronic
922977363 1:229796682-229796704 GTCATAGTCCCAGAGTTAGACGG + Intergenic
924537290 1:244946429-244946451 ATAATAGTCCCATAGTGTGGTGG - Intergenic
1063705255 10:8424064-8424086 TTAATATTTCAATAGTTTGGGGG - Intergenic
1064772508 10:18738049-18738071 GAAATAGGCCCAGATTTTGGTGG + Intergenic
1067993749 10:51245378-51245400 AAAATAGTGCCAGGGTTTGGGGG - Intronic
1068019572 10:51564356-51564378 TAAAAAGGCCTAGAGTTTGGGGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1070910852 10:80116623-80116645 TTTATAATACCTGAGTTTGGGGG + Intergenic
1074740188 10:116479015-116479037 TCAATAGTCACAGAGAGTGGAGG - Intergenic
1075105240 10:119535738-119535760 TTAATAGTCTGTGAGTTTGGGGG - Intronic
1079740541 11:24053893-24053915 TTAATGGTCCCAGTCTTAGGAGG + Intergenic
1087986489 11:104688094-104688116 TTTATACTCTCACAGTTTGGAGG + Intergenic
1090249054 11:125238297-125238319 TAAAAAGTGCTAGAGTTTGGAGG + Intronic
1090344071 11:126053338-126053360 TTAGTAGTCCCAGGGTTTACTGG + Intronic
1092610528 12:10167574-10167596 CTAATAGTCACTGAGTCTGGTGG - Intronic
1094056007 12:26270166-26270188 CTGATAGTCCCAGATTCTGGAGG - Intronic
1096825793 12:54276668-54276690 TTTATAGACCCAGGGTTTTGGGG - Intronic
1097472536 12:60012769-60012791 TTAATAATCACAGGGTTTGGGGG - Intergenic
1100762052 12:97819085-97819107 TTGAAAGTGCAAGAGTTTGGGGG - Intergenic
1100790056 12:98120417-98120439 TTGATAGTACCATAGTTTGAAGG - Intergenic
1101546139 12:105714849-105714871 AGAATAGTCACAGAGTTGGGAGG - Intergenic
1101719002 12:107334930-107334952 GAAATACTCACAGAGTTTGGGGG - Intronic
1108012835 13:46038039-46038061 TTACTAGTTCCAGGGTCTGGAGG + Intronic
1110918582 13:81055889-81055911 TTATTACTCCCACATTTTGGTGG - Intergenic
1112709831 13:102114879-102114901 TGAATAGCTCCAGAGATTGGGGG + Intronic
1113577986 13:111407728-111407750 TGGAGAGTCCCAGAGTGTGGGGG - Intergenic
1117454796 14:55886305-55886327 TGAAAAGACCCAGTGTTTGGTGG - Intergenic
1118502114 14:66371536-66371558 TTAATTGACTCACAGTTTGGCGG + Intergenic
1119980343 14:79073546-79073568 TTACTAGGACCAGTGTTTGGTGG + Intronic
1127325644 15:57892431-57892453 TGAATCATCCCAGAGTTTAGTGG - Intergenic
1127972564 15:63973049-63973071 TTCATAGTGCCAGAGCTTAGAGG + Intronic
1132928047 16:2443246-2443268 TTAATAATCACAGTGTTTGCTGG + Intronic
1134089506 16:11384089-11384111 TTCGTAGGCCCAGGGTTTGGGGG - Intronic
1135975510 16:27106709-27106731 TTTATATTACCAGAGTTTTGGGG + Intergenic
1140032535 16:71349972-71349994 TTTATGGAGCCAGAGTTTGGAGG - Intergenic
1143805773 17:9424954-9424976 TTAAAAGTGCCAGAGTGTAGAGG + Intronic
1147603139 17:41758319-41758341 TTAGGAGTCCCAGATTTGGGAGG - Intronic
1149344834 17:55724342-55724364 TGAAAAGTCCCTGAGGTTGGGGG + Intronic
1152094401 17:78264648-78264670 TTCATAGTGGCAGAGTTTGCAGG + Intergenic
1156479175 18:37425470-37425492 TTAATAAACCCACAGTTAGGAGG - Intronic
1159324812 18:66901165-66901187 TAAAAAGACACAGAGTTTGGTGG - Intergenic
1161567953 19:5013779-5013801 GAAATAGTCCCAGGGTCTGGGGG + Intronic
1168528585 19:57107148-57107170 CTAATATTTCCACAGTTTGGGGG + Intergenic
925941644 2:8826256-8826278 TTAATAATCCCAAAGTGTGTGGG + Intronic
928077493 2:28278521-28278543 TTAAGAGTACCAGAATCTGGAGG + Intronic
928278177 2:29921076-29921098 TTAAAAGTTGCAGAGATTGGAGG - Exonic
930213676 2:48670695-48670717 TTAATAGTCCCAAAGTCCTGTGG + Intronic
930469350 2:51793249-51793271 TTTATAGGCCCACAGTTGGGAGG - Intergenic
931375802 2:61706831-61706853 CTAATTGTCCCAGACATTGGAGG - Intergenic
932242939 2:70171896-70171918 TTAATGGAGCCAGAGTTTAGAGG + Intronic
932653367 2:73584638-73584660 TTATTATTTCCATAGTTTGGAGG + Intronic
933007329 2:77012697-77012719 TGCATAATCACAGAGTTTGGGGG - Intronic
939821839 2:146967211-146967233 TTAATAATCCCAGTTTTTGTTGG - Intergenic
944164208 2:196700873-196700895 TTAAGAGTACCAGAGTTTGTTGG - Intronic
946034608 2:216731798-216731820 CTCAAAGTTCCAGAGTTTGGAGG - Intergenic
1175266279 20:57705407-57705429 TGAAAAGTCCCAGGGTTTAGCGG + Intronic
1177494264 21:21868765-21868787 TTAATAGTTTCATAGTTTGAGGG + Intergenic
1178895917 21:36556745-36556767 TTGATGGTCCCTGATTTTGGTGG + Intronic
1182752377 22:32652002-32652024 TTAATAGTGCCAGAGTTGAGAGG + Intronic
956977109 3:74594204-74594226 TTAATAGTGCTAGAGACTGGTGG - Intergenic
957324405 3:78674563-78674585 TTAAAACGCCCAGAGTTTGCAGG + Intronic
959404571 3:105944419-105944441 TTATTAGTTCCAGAGTGTTGTGG + Intergenic
964948694 3:162260463-162260485 TTAAGAATCCCAGGGTTTGAGGG - Intergenic
967307475 3:188073187-188073209 TTATTAGTATCTGAGTTTGGAGG - Intergenic
969352942 4:6608653-6608675 TTAACAGTCCCTGCCTTTGGGGG + Intronic
971650738 4:29269970-29269992 TTCAAGGTCCCAGAGTTTTGTGG - Intergenic
972584830 4:40428236-40428258 AGAATAGTGCCTGAGTTTGGGGG - Intronic
972952845 4:44349878-44349900 TTATTTGGCCCAGATTTTGGTGG - Intronic
974424433 4:61722875-61722897 TTAATAGTCCCAGAGTTTGGAGG - Intronic
974623963 4:64398601-64398623 TTAATTGTCCCATAGTTCTGTGG - Intronic
978625905 4:110684858-110684880 TTTAAAGTGCCAGAATTTGGGGG - Intergenic
979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG + Intergenic
980244303 4:130218650-130218672 TTAGTAGTTTCATAGTTTGGGGG + Intergenic
980249509 4:130296171-130296193 TTACTAATCACAGAGTTTTGTGG - Intergenic
981570940 4:146149712-146149734 GTAATTGTCCCACAGTTTGGGGG + Intergenic
981736998 4:147963581-147963603 ATAATAATTCCAAAGTTTGGGGG + Intronic
981815951 4:148830568-148830590 TTACTAATACCATAGTTTGGGGG - Intergenic
982121085 4:152144523-152144545 TTAATGGTAAGAGAGTTTGGGGG - Intergenic
983568185 4:169176280-169176302 TGGACAGTCCCAGAGCTTGGGGG - Intronic
984952505 4:185017921-185017943 TTAATAATGCCAGAGGGTGGGGG - Intergenic
985157857 4:187011228-187011250 TTAATATGACCAGAGTCTGGAGG - Intergenic
987302917 5:16612616-16612638 GTAACAGTCCCATAGTTTTGTGG - Intronic
988547221 5:32169727-32169749 TTAATTGACCCAGTGTTTGAGGG - Intronic
990188749 5:53234495-53234517 TTAAAGGTGCCATAGTTTGGGGG - Intergenic
990853502 5:60235757-60235779 TTAATATTTTCAGAGTTTGAGGG + Intronic
995126783 5:108585010-108585032 TTATTAGTCCCATAATATGGAGG + Intergenic
999436470 5:151567363-151567385 TTCATAGTCCATGGGTTTGGAGG + Exonic
1009577488 6:65485166-65485188 TTAATAGTGGCACAGTTTAGGGG - Intronic
1019509341 7:1409585-1409607 TTTATAGTTCCACAGTCTGGAGG + Intergenic
1020820759 7:12964478-12964500 CTAATATTCCCAGAGTTTTGGGG + Intergenic
1022335022 7:29414268-29414290 TTTACAATCCCAGAGTTCGGGGG - Intronic
1030960795 7:115919007-115919029 TTATTAGACTCAGACTTTGGGGG + Intergenic
1033788074 7:144757874-144757896 TTAATAGTCCTAGTTCTTGGGGG - Intronic
1035542047 8:447823-447845 CAAAAAGTTCCAGAGTTTGGAGG + Intronic
1039159191 8:34597887-34597909 TCCAGAGTCTCAGAGTTTGGTGG - Intergenic
1040700882 8:50064072-50064094 ATAATAGCCCCAGAGTTAGCTGG - Intronic
1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG + Intronic
1047820523 8:128514760-128514782 TTAGTAGTCAGAGTGTTTGGAGG + Intergenic
1048718116 8:137291089-137291111 TTAATAAGTCTAGAGTTTGGGGG - Intergenic
1052039424 9:23721013-23721035 CTAATATGCCCAGAGTTTTGAGG - Intronic
1052372355 9:27679655-27679677 TTAATAGACTCCAAGTTTGGTGG - Intergenic
1058205220 9:102097238-102097260 TTAAAAGTCCCAGAATTTCAGGG - Intergenic
1058268054 9:102932381-102932403 TTTACAATCCCAGGGTTTGGGGG - Intergenic
1188858578 X:35228556-35228578 ATAATAGTCCCTGAGTATAGAGG - Intergenic
1191005227 X:55703915-55703937 CAAATAGTCCCATATTTTGGGGG - Intergenic
1191738091 X:64408296-64408318 TTAAGAGACCAAGAGTTTGGAGG - Intergenic
1192104351 X:68299492-68299514 TTCAAAGTCCCAGAGCTTGGTGG + Intronic
1194249937 X:91562398-91562420 TAAATAGACCCAGAGTCTGCTGG - Intergenic
1196191099 X:112795670-112795692 TGCAGAGTCCCAGTGTTTGGTGG + Intronic
1197153681 X:123247371-123247393 TTTATAGTCCCCGAGTCTGTAGG - Intronic
1198915772 X:141670050-141670072 TTAATAGTCTCACAGATTGCTGG + Intronic
1201746854 Y:17385542-17385564 TGAATAGTCACAGAGTTTGAGGG - Intergenic