ID: 974429769

View in Genome Browser
Species Human (GRCh38)
Location 4:61780640-61780662
Sequence CAGTGGGAATGGATGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1126
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 509}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974429769 Original CRISPR CAGTGGGAATGGATGGAAGA AGG (reversed) Intronic
900404510 1:2486517-2486539 CAGTGGGAGGGGCTGGATGAGGG + Intronic
900404510 1:2486517-2486539 CAGTGGGAGGGGCTGGATGAGGG + Intronic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901169072 1:7242327-7242349 TAGTGGGAATGAATGGAAAATGG + Intronic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
901249882 1:7770125-7770147 CAGATGGATTAGATGGAAGAGGG - Intergenic
901758800 1:11457367-11457389 GATGGGGAAGGGATGGAAGAAGG + Intergenic
901758800 1:11457367-11457389 GATGGGGAAGGGATGGAAGAAGG + Intergenic
902298636 1:15485791-15485813 ATGTTGCAATGGATGGAAGATGG + Intronic
902298636 1:15485791-15485813 ATGTTGCAATGGATGGAAGATGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902512797 1:16975373-16975395 CAGTGGGATTGGGTGGAAGTGGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903275036 1:22216197-22216219 CAGTGGGAATGGGGAGGAGAGGG + Intergenic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
904288316 1:29468013-29468035 GAGTGGGAAAGGATGGGAGGAGG - Intergenic
904288316 1:29468013-29468035 GAGTGGGAAAGGATGGGAGGAGG - Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904309772 1:29621236-29621258 CAGTGGGAATGGGAAGGAGAAGG + Intergenic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904595382 1:31641357-31641379 CTGTGAGAATGGATTGAAGCAGG - Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
904894094 1:33801159-33801181 GAGGGGGCATGGAAGGAAGAGGG - Intronic
905242920 1:36592776-36592798 TAGTGGGAAAGTATGGAACAGGG - Intergenic
905242920 1:36592776-36592798 TAGTGGGAAAGTATGGAACAGGG - Intergenic
905246746 1:36620233-36620255 CAATGGCAGTGGATGGAATAAGG + Intergenic
905246746 1:36620233-36620255 CAATGGCAGTGGATGGAATAAGG + Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
905573042 1:39021223-39021245 CAGAGAGAATGGAAGGAAGGAGG - Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907296926 1:53461303-53461325 CAGTGGGGCTGGCTGGAGGATGG + Intronic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907355436 1:53869078-53869100 AAGTGGGCATGGAAGGTAGAGGG + Intronic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
907613348 1:55895631-55895653 AAGTGGGACTGGATTGAGGAAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909609489 1:77537472-77537494 TATGGGGAATGGATGCAAGAAGG + Intronic
909609489 1:77537472-77537494 TATGGGGAATGGATGCAAGAAGG + Intronic
910039491 1:82832197-82832219 CTTTGGGAATGGATGGTATAGGG + Intergenic
910039491 1:82832197-82832219 CTTTGGGAATGGATGGTATAGGG + Intergenic
910057960 1:83054276-83054298 TATTGACAATGGATGGAAGAAGG - Intergenic
910057960 1:83054276-83054298 TATTGACAATGGATGGAAGAAGG - Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910377400 1:86587527-86587549 CAATGGGAAGGGAAGGAAAATGG - Intergenic
910430839 1:87158319-87158341 GAGAGGGAAAGGAAGGAAGATGG - Intronic
910430839 1:87158319-87158341 GAGAGGGAAAGGAAGGAAGATGG - Intronic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
910442668 1:87268478-87268500 CAGTGGGAATGGTAGGAAATGGG + Intergenic
911389975 1:97229442-97229464 CAGTTAGAATGGAAGAAAGATGG + Intronic
911389975 1:97229442-97229464 CAGTTAGAATGGAAGAAAGATGG + Intronic
913369191 1:118078113-118078135 CAATTGGAGTGAATGGAAGAGGG - Intronic
913369191 1:118078113-118078135 CAATTGGAGTGAATGGAAGAGGG - Intronic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915013587 1:152712777-152712799 GAGTGGGAATGGAGGTAAGGAGG + Intergenic
915235123 1:154474830-154474852 CAGAGGGAGTGGATGTAATAAGG - Intronic
915235123 1:154474830-154474852 CAGAGGGAGTGGATGTAATAAGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915457501 1:156050662-156050684 CTGTGGGAATGACAGGAAGAGGG - Intronic
915909892 1:159908440-159908462 CAGTGAGAATGGGTTGAAAATGG - Intergenic
915909892 1:159908440-159908462 CAGTGAGAATGGGTTGAAAATGG - Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
915921180 1:159976736-159976758 CAATGGGAATGGTTGGGAGGAGG + Intergenic
915921180 1:159976736-159976758 CAATGGGAATGGTTGGGAGGAGG + Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
916592379 1:166204859-166204881 CAGTGGGAGTTGGGGGAAGAGGG - Intergenic
917215329 1:172672247-172672269 CAGTAGGGAGTGATGGAAGAAGG + Intergenic
917215329 1:172672247-172672269 CAGTAGGGAGTGATGGAAGAAGG + Intergenic
918420866 1:184363274-184363296 TAGAGGGAATGGATGTAAGGTGG - Intergenic
918420866 1:184363274-184363296 TAGAGGGAATGGATGTAAGGTGG - Intergenic
919666836 1:200300596-200300618 CAGTGTGCATGGATGGGACAGGG - Intergenic
919666836 1:200300596-200300618 CAGTGTGCATGGATGGGACAGGG - Intergenic
921111543 1:212043009-212043031 CAGTCAGAAGGGATTGAAGAGGG - Exonic
921111543 1:212043009-212043031 CAGTCAGAAGGGATTGAAGAGGG - Exonic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921490189 1:215766075-215766097 CAGTTGGAAGGAATGTAAGATGG - Intronic
921490189 1:215766075-215766097 CAGTTGGAAGGAATGTAAGATGG - Intronic
921959860 1:221023240-221023262 CAGTGGGAATTGGTGGATGCTGG - Intergenic
921959860 1:221023240-221023262 CAGTGGGAATTGGTGGATGCTGG - Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922020560 1:221700110-221700132 GAGAGGGAATGGAAGGGAGAGGG + Intergenic
922095085 1:222436463-222436485 CAGAGGTAAAGGATGGAAAAGGG + Intergenic
922095085 1:222436463-222436485 CAGAGGTAAAGGATGGAAAAGGG + Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
922095441 1:222439461-222439483 CACTGGGAATGGGGGGACGAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924297684 1:242604781-242604803 AAATGGGGGTGGATGGAAGAGGG + Intergenic
924297684 1:242604781-242604803 AAATGGGGGTGGATGGAAGAGGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1063869593 10:10403293-10403315 CAGGAGGAATGGAAAGAAGAGGG + Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064183838 10:13143043-13143065 CAGGGGGTAGGGAAGGAAGATGG - Intergenic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1064478374 10:15715960-15715982 CAGTGGGAATGGCCTGAAAATGG - Intronic
1065488500 10:26257407-26257429 CAGGGAGAATGAGTGGAAGAAGG - Intronic
1065488500 10:26257407-26257429 CAGGGAGAATGAGTGGAAGAAGG - Intronic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065961146 10:30735228-30735250 CAGTGGGTATGAGAGGAAGACGG + Intergenic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1065975936 10:30842437-30842459 CATTGAGAATGGTGGGAAGAGGG - Intronic
1068440754 10:57052848-57052870 CATTCAGAATGGATGGAGGAAGG + Intergenic
1068440754 10:57052848-57052870 CATTCAGAATGGATGGAGGAAGG + Intergenic
1069113399 10:64474396-64474418 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
1069113399 10:64474396-64474418 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069757318 10:70781334-70781356 CAGTGGGGAGGGATGGGAGATGG - Intronic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1069994508 10:72334303-72334325 CAGTGGGAAGGGCTGGGGGAGGG - Exonic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071275351 10:84049103-84049125 CAGTGGGGGTGGAGGGTAGAAGG + Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1074001682 10:109379837-109379859 TAGTGGGACTGGATTCAAGATGG - Intergenic
1074001682 10:109379837-109379859 TAGTGGGACTGGATTCAAGATGG - Intergenic
1074102282 10:110363290-110363312 GGGTGGGATTGGATGAAAGAGGG - Intergenic
1074102282 10:110363290-110363312 GGGTGGGATTGGATGAAAGAGGG - Intergenic
1075346063 10:121682689-121682711 CCTTAGGAATGGATGGCAGAGGG - Intergenic
1075346063 10:121682689-121682711 CCTTAGGAATGGATGGCAGAGGG - Intergenic
1076623750 10:131809210-131809232 CACTGGGAATGAATGGTGGACGG - Intergenic
1076623750 10:131809210-131809232 CACTGGGAATGAATGGTGGACGG - Intergenic
1076623763 10:131809254-131809276 CACTGGGAATGAATGGCAAATGG - Intergenic
1076623763 10:131809254-131809276 CACTGGGAATGAATGGCAAATGG - Intergenic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1076676738 10:132151013-132151035 GAGAAGGAATGGATGGAGGATGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1079346758 11:19659399-19659421 CAATGGGAAGGCATTGAAGAAGG + Intronic
1079346758 11:19659399-19659421 CAATGGGAAGGCATTGAAGAAGG + Intronic
1081292871 11:41348652-41348674 CATTGAGAATGGATGGAGGGAGG + Intronic
1081292871 11:41348652-41348674 CATTGAGAATGGATGGAGGGAGG + Intronic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081479467 11:43471595-43471617 CCGTGGGAAGGGATGAAAGCTGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1084925959 11:72511401-72511423 CTTTGAGAATGGATGGAAGTAGG - Intergenic
1085184030 11:74560141-74560163 CCATGGGAGTGGATGGATGAAGG - Intronic
1085184030 11:74560141-74560163 CCATGGGAGTGGATGGATGAAGG - Intronic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1085804566 11:79623245-79623267 CTGTGGGAATTGATAGAGGAAGG - Intergenic
1086512076 11:87569790-87569812 TAGGGGGAAGGGATGGGAGATGG + Intergenic
1086512076 11:87569790-87569812 TAGGGGGAAGGGATGGGAGATGG + Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1087955564 11:104282785-104282807 CAGGGGTAATGGAGGGAATAAGG - Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088704703 11:112451519-112451541 CAAAGGCAATGGATGGAGGATGG - Intergenic
1088704703 11:112451519-112451541 CAAAGGCAATGGATGGAGGATGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089052187 11:115555525-115555547 CAGTGGGAGTGGATGATGGATGG + Intergenic
1089611074 11:119669536-119669558 CAGAGGGAAAGGATGGAATCAGG - Intronic
1089611074 11:119669536-119669558 CAGAGGGAAAGGATGGAATCAGG - Intronic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091161847 11:133429951-133429973 CAGTGAGTCTGGATGGAAGCGGG + Intronic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1091767894 12:3133786-3133808 CTGTGAAAATGGATGGATGACGG + Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1093084919 12:14856282-14856304 CAAAGGGCAGGGATGGAAGAAGG - Intronic
1093084919 12:14856282-14856304 CAAAGGGCAGGGATGGAAGAAGG - Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093233974 12:16583703-16583725 CTGTAGGAATGGATTGAAAAAGG + Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1093988793 12:25567691-25567713 CAGTGAGAGTGGAAGCAAGATGG - Intronic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1094220118 12:27983918-27983940 TGGGGGGAAAGGATGGAAGATGG + Intergenic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1098159884 12:67639834-67639856 CACTGGGAAAGGATTGAGGAGGG + Intergenic
1098159884 12:67639834-67639856 CACTGGGAAAGGATTGAGGAGGG + Intergenic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1098450495 12:70613150-70613172 CAGTGGTGTTGGATGGATGAGGG + Intronic
1099054329 12:77819605-77819627 CAGTGGGAAAGCATTGAGGAGGG + Intergenic
1099054329 12:77819605-77819627 CAGTGGGAAAGCATTGAGGAGGG + Intergenic
1099246581 12:80199983-80200005 CAGTGGGAAGGATTGGAACATGG - Intergenic
1099246581 12:80199983-80200005 CAGTGGGAAGGATTGGAACATGG - Intergenic
1100213797 12:92426801-92426823 CATTGGGATTTGATGGTAGAAGG + Intronic
1100213797 12:92426801-92426823 CATTGGGATTTGATGGTAGAAGG + Intronic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102736104 12:115161105-115161127 CAGTAGGAAGGGAAGGAAGGCGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103254776 12:119531679-119531701 CAGTGAGTATGGAAGGAAGCAGG + Intronic
1103403912 12:120661375-120661397 CATGGGGAAGGGATGGGAGATGG - Intronic
1103403912 12:120661375-120661397 CATGGGGAAGGGATGGGAGATGG - Intronic
1103409272 12:120699251-120699273 CATAGGGAATGTATGGGAGATGG + Exonic
1103409272 12:120699251-120699273 CATAGGGAATGTATGGGAGATGG + Exonic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1103767720 12:123293540-123293562 CAGTGTGAATGGATGGGAGCTGG - Exonic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1111855730 13:93634700-93634722 CAGTAGGAAAGGAAGGAAGAAGG + Intronic
1112242806 13:97698768-97698790 TAGAGTGAATGGATGGAGGATGG + Intergenic
1112242806 13:97698768-97698790 TAGAGTGAATGGATGGAGGATGG + Intergenic
1112949502 13:104975217-104975239 CAATGGCAAGGGATGGAACAGGG + Intergenic
1112949502 13:104975217-104975239 CAATGGCAAGGGATGGAACAGGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1114879806 14:26770114-26770136 GAGTGGGAAGGGAAGGAGGAGGG + Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1115926628 14:38442966-38442988 GAGTGGGAAGGGTGGGAAGAGGG - Intergenic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1116635327 14:47387346-47387368 TAGAGGGAAAGGATGGAAGCTGG + Intronic
1116635327 14:47387346-47387368 TAGAGGGAAAGGATGGAAGCTGG + Intronic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1117841242 14:59862647-59862669 CAGTGGGAACAGATGGGAAATGG - Intronic
1118014615 14:61646854-61646876 CAGTGGGAACTGATCTAAGAAGG - Intronic
1118014615 14:61646854-61646876 CAGTGGGAACTGATCTAAGAAGG - Intronic
1118114663 14:62761865-62761887 CATTGAGAATGGATGGAGGGAGG + Intronic
1118114663 14:62761865-62761887 CATTGAGAATGGATGGAGGGAGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118337116 14:64863036-64863058 CAGTAGGAATGGAAGGGAGGTGG - Intronic
1118646683 14:67847141-67847163 CAATGAGAATGGATGGAGGGAGG - Intronic
1118646683 14:67847141-67847163 CAATGAGAATGGATGGAGGGAGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1118894766 14:69936536-69936558 CAGTGGGAGGGGAAGGAGGAAGG - Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119192872 14:72695696-72695718 AAGGGGGAAGGGAAGGAAGAGGG + Intronic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1122600697 14:102920273-102920295 TAGTGGGAGTGGATGGTGGATGG - Intergenic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1122870491 14:104635983-104636005 CAGTTGGAATGGAAGGAGGCGGG - Intergenic
1123122296 14:105922268-105922290 CATTGGGAAGGGATGGAGGATGG + Exonic
1123122296 14:105922268-105922290 CATTGGGAAGGGATGGAGGATGG + Exonic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1125609031 15:40958498-40958520 CAGTGGGAATGGACAGTGGAGGG + Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127028483 15:54834580-54834602 ATGGGGGAATAGATGGAAGAGGG - Intergenic
1127229393 15:56971898-56971920 TAGCGGGAGTAGATGGAAGAAGG + Intronic
1127229393 15:56971898-56971920 TAGCGGGAGTAGATGGAAGAAGG + Intronic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1127574482 15:60277297-60277319 AGGTGGGAAAGGATGGGAGAGGG + Intergenic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1128536114 15:68491851-68491873 CAGGGGGGCTGGAAGGAAGAGGG + Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131589325 15:93731216-93731238 CATTGGGACTGGTTGGACGATGG - Intergenic
1131589325 15:93731216-93731238 CATTGGGACTGGTTGGACGATGG - Intergenic
1131983282 15:98016796-98016818 GAGAGGGAAGGGATAGAAGAGGG - Intergenic
1131983282 15:98016796-98016818 GAGAGGGAAGGGATAGAAGAGGG - Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1133013021 16:2925329-2925351 GTATGGGAATGGATGGACGATGG - Intronic
1133013021 16:2925329-2925351 GTATGGGAATGGATGGACGATGG - Intronic
1133388762 16:5392126-5392148 CAGGGGGAAAGGATGGGAGGAGG + Intergenic
1133388762 16:5392126-5392148 CAGGGGGAAAGGATGGGAGGAGG + Intergenic
1133812814 16:9174301-9174323 CAATGAGGATGGATGGAGGAAGG + Intergenic
1133812814 16:9174301-9174323 CAATGAGGATGGATGGAGGAAGG + Intergenic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1137561654 16:49506303-49506325 ATGGGGGAATGGATGGTAGACGG + Intronic
1138270508 16:55692516-55692538 CAGGGGGAGTGGTTGGATGAGGG - Intronic
1138270508 16:55692516-55692538 CAGGGGGAGTGGTTGGATGAGGG - Intronic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1138647658 16:58436880-58436902 AAGGAGGGATGGATGGAAGAGGG - Intergenic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1141364071 16:83426131-83426153 GAGAAGGAATGGATGAAAGAGGG - Intronic
1141364071 16:83426131-83426153 GAGAAGGAATGGATGAAAGAGGG - Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1143156138 17:4837635-4837657 CAGTGGAAGTGGATGGGACAAGG + Intronic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143508974 17:7384787-7384809 GAGAGCGAATGGAGGGAAGAGGG - Intronic
1143583034 17:7837247-7837269 AAGTGGGAGTGGTTGAAAGACGG + Intergenic
1143583034 17:7837247-7837269 AAGTGGGAGTGGTTGAAAGACGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1145834218 17:27941734-27941756 CAGTAGCAAAGGATGGAAGTTGG + Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146010624 17:29191621-29191643 CAGTGGGAATGAGTGGCTGATGG - Intergenic
1146010624 17:29191621-29191643 CAGTGGGAATGAGTGGCTGATGG - Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146931845 17:36783230-36783252 CAGTGGGAATGCCTGGAATTTGG - Intergenic
1146931845 17:36783230-36783252 CAGTGGGAATGCCTGGAATTTGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147495575 17:40912059-40912081 CAGTGTGGATGGGTGGAAGAGGG + Intergenic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1147725521 17:42564197-42564219 CAGAGGGAGTGGATGGGGGACGG + Intronic
1148029374 17:44608969-44608991 CAGTGGGAAGGGGTGGCAAAGGG + Intergenic
1148029374 17:44608969-44608991 CAGTGGGAAGGGGTGGCAAAGGG + Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148861289 17:50605659-50605681 CAGTGGGAAAGGGTGGAGGCGGG - Intronic
1148861289 17:50605659-50605681 CAGTGGGAAAGGGTGGAGGCGGG - Intronic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1149520436 17:57314491-57314513 CAGTGGCAAGAGATGGAAAAGGG + Intronic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150271569 17:63869311-63869333 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150275104 17:63892192-63892214 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150277243 17:63906953-63906975 CTGTGGGGAGGGATGGAATAGGG - Intergenic
1150611569 17:66737706-66737728 CAGTGGGAACGGCTGGGAGCAGG - Intronic
1150611569 17:66737706-66737728 CAGTGGGAACGGCTGGGAGCAGG - Intronic
1151564778 17:74892028-74892050 AACTGGGAAGGGGTGGAAGAAGG + Intronic
1151564778 17:74892028-74892050 AACTGGGAAGGGGTGGAAGAAGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1152559516 17:81070919-81070941 CAGTGGGGGTGGATGACAGAAGG + Intronic
1153167084 18:2274250-2274272 CAGTGGCATTGGATGGATGGGGG + Intergenic
1153167084 18:2274250-2274272 CAGTGGCATTGGATGGATGGGGG + Intergenic
1153763105 18:8350578-8350600 CACATGGAATGGATAGAAGATGG - Intronic
1153763105 18:8350578-8350600 CACATGGAATGGATAGAAGATGG - Intronic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155156701 18:23163551-23163573 CTGAGAGAAAGGATGGAAGAGGG + Intronic
1155478702 18:26262120-26262142 GAATGGGAATGGGTGAAAGAAGG + Intronic
1155478702 18:26262120-26262142 GAATGGGAATGGGTGAAAGAAGG + Intronic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1155869608 18:31009498-31009520 TAGTGGGCATGGATGGATAAAGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157213487 18:45763301-45763323 CAGAGAGAATGGAGGGAAGAGGG + Intergenic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157486469 18:48090795-48090817 CAGTGGAACTGGAAGGTAGATGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1158339916 18:56454808-56454830 GAGAGGGAAAGGAAGGAAGAAGG + Intergenic
1158339916 18:56454808-56454830 GAGAGGGAAAGGAAGGAAGAAGG + Intergenic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1158376473 18:56875465-56875487 CAGTGGGAAGGTATGCAAGATGG - Intronic
1158409003 18:57187711-57187733 CAGTGGGACAGGATGGGATAGGG + Intergenic
1158409003 18:57187711-57187733 CAGTGGGACAGGATGGGATAGGG + Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158551810 18:58442560-58442582 CAGTGGGGCTGGAAGGAAGCTGG - Intergenic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1158716984 18:59889314-59889336 CAGCGAGAATAGATGGAAAAAGG + Intergenic
1159024253 18:63168170-63168192 CATTGGCAATGGATGGAACAAGG - Intronic
1159024253 18:63168170-63168192 CATTGGCAATGGATGGAACAAGG - Intronic
1159529597 18:69638727-69638749 CAATGGGAATAGCTTGAAGAAGG + Intronic
1159529597 18:69638727-69638749 CAATGGGAATAGCTTGAAGAAGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161051363 19:2165386-2165408 CGGTGCGAGTGGATGGGAGAGGG + Intronic
1161051363 19:2165386-2165408 CGGTGCGAGTGGATGGGAGAGGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1162950816 19:14071405-14071427 CAGTTGGCATGGCTGGAGGAAGG + Intergenic
1163055099 19:14712029-14712051 TAGCGGGAATGGGTGGGAGAGGG + Intronic
1163055099 19:14712029-14712051 TAGCGGGAATGGGTGGGAGAGGG + Intronic
1164121094 19:22266047-22266069 CAGTGAGAAGGGATGGATGAAGG - Intergenic
1164121094 19:22266047-22266069 CAGTGAGAAGGGATGGATGAAGG - Intergenic
1164178845 19:22802164-22802186 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1164178845 19:22802164-22802186 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1165860788 19:38908158-38908180 CAGAGGGAAGGGGTGGAGGAGGG + Intronic
1165860788 19:38908158-38908180 CAGAGGGAAGGGGTGGAGGAGGG + Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
925030203 2:644535-644557 CAGTGTGAATGAATGGATGGAGG + Intergenic
925030203 2:644535-644557 CAGTGTGAATGAATGGATGGAGG + Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926171146 2:10553222-10553244 CCTTGGGAATGGAAGGAACAGGG + Intergenic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
926670235 2:15570210-15570232 GTGTGGGAATCCATGGAAGACGG - Intergenic
927375309 2:22406346-22406368 CAGTGGGAAATGACTGAAGAAGG + Intergenic
927375309 2:22406346-22406368 CAGTGGGAAATGACTGAAGAAGG + Intergenic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927500470 2:23579577-23579599 AAGTGGGACTGGAGGGAAAAGGG - Intronic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929592206 2:43154700-43154722 GAGTGGGGATGGATGGAGGTTGG + Intergenic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
929896450 2:45964594-45964616 AACTGTGAATGGATGGAGGAGGG + Intronic
929896450 2:45964594-45964616 AACTGTGAATGGATGGAGGAGGG + Intronic
930685186 2:54300207-54300229 GAGTGGTAATTGATGGAACAAGG - Intronic
930685186 2:54300207-54300229 GAGTGGTAATTGATGGAACAAGG - Intronic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931160054 2:59679583-59679605 AAGTGGGGATGGTGGGAAGATGG - Intergenic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
931174072 2:59835313-59835335 AAGGGGGAAGGGAAGGAAGAAGG - Intergenic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932022724 2:68104053-68104075 AGGTGGGAGTGGAAGGAAGAAGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
932875067 2:75442805-75442827 AAGTGGGAAGGGTGGGAAGAGGG + Intergenic
933549559 2:83758765-83758787 CAGTGGGAATGAATGGGGAAAGG - Intergenic
933549559 2:83758765-83758787 CAGTGGGAATGAATGGGGAAAGG - Intergenic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
933726520 2:85430493-85430515 CAGCAGGAATGGAGGGGAGAGGG - Intronic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934171571 2:89544714-89544736 CTGAGGGACTGGATGGGAGAGGG + Intergenic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
934987795 2:98900150-98900172 CAGTGGGAAGGGGAGGCAGATGG + Intronic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937563428 2:123254233-123254255 AAATGGGAATAGATAGAAGAAGG + Intergenic
937563428 2:123254233-123254255 AAATGGGAATAGATAGAAGAAGG + Intergenic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938343165 2:130548844-130548866 CTGTGGGAGTGCATGCAAGAGGG - Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
938346668 2:130571878-130571900 CTGTGGGAGTGCATGCAAGAGGG + Intronic
939779499 2:146428107-146428129 CAATGTGAATGAATGGAATAAGG + Intergenic
939779499 2:146428107-146428129 CAATGTGAATGAATGGAATAAGG + Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
940599701 2:155843195-155843217 AAGTGAGAAAGGAAGGAAGATGG - Intergenic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941751842 2:169142554-169142576 GAGTGGGGATGGCTGGAAGGAGG - Intronic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
941995973 2:171602431-171602453 CTGAGGGATTGGCTGGAAGATGG - Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944443774 2:199769168-199769190 CTGTGGGAAAGGATGAAAAATGG - Intronic
944679653 2:202065406-202065428 GATTGGGGATTGATGGAAGAGGG - Intergenic
944679653 2:202065406-202065428 GATTGGGGATTGATGGAAGAGGG - Intergenic
944883260 2:204037140-204037162 CAGAGAGAAGGGATTGAAGAGGG + Intergenic
944883260 2:204037140-204037162 CAGAGAGAAGGGATTGAAGAGGG + Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945849979 2:214993667-214993689 CAGTGGTAATGTATGTAAGTAGG + Intronic
945849979 2:214993667-214993689 CAGTGGTAATGTATGTAAGTAGG + Intronic
946410091 2:219511436-219511458 CAGTGAGAATGAGTGGTAGATGG - Intergenic
946410091 2:219511436-219511458 CAGTGAGAATGAGTGGTAGATGG - Intergenic
946672496 2:222121231-222121253 AAGAAGGAATGGATGGAGGAAGG + Intergenic
946672496 2:222121231-222121253 AAGAAGGAATGGATGGAGGAAGG + Intergenic
947291468 2:228580057-228580079 CAGTGAGAAGGGATGGAATGTGG + Intergenic
947291468 2:228580057-228580079 CAGTGAGAAGGGATGGAATGTGG + Intergenic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947398694 2:229712466-229712488 TAGTGGGAATGGATGGGAGAAGG - Intronic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
947648101 2:231759677-231759699 AAGAGGGAGTTGATGGAAGATGG - Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458434 2:238118001-238118023 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458442 2:238118030-238118052 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948458469 2:238118129-238118151 GAGAAGGAATGGATGGAGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458512 2:238118284-238118306 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458630 2:238118715-238118737 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458661 2:238118815-238118837 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458740 2:238119140-238119162 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
948458754 2:238119183-238119205 GAGGAGGAATGGATGGAGGAGGG + Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169055235 20:2615372-2615394 CAGCATGCATGGATGGAAGAAGG - Intronic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1169273591 20:4218538-4218560 CAGTGGGAGTGGAGGCAGGAAGG - Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170084182 20:12510677-12510699 CAGTGGGACTTGGTGGAAAATGG + Intergenic
1170125631 20:12960320-12960342 CAGGGGGAAAGGATGGGACAGGG + Intergenic
1170125631 20:12960320-12960342 CAGGGGGAAAGGATGGGACAGGG + Intergenic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1170698970 20:18686008-18686030 CACTGGGAAGGGAAGTAAGAAGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172600271 20:36178352-36178374 CAATGGGACTGGCAGGAAGAAGG - Intronic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1172754912 20:37276760-37276782 CTCTGGAAATGGATGGTAGACGG + Intergenic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1172970609 20:38870644-38870666 CAGTGGGAAGGGAAGGGACAGGG + Intronic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174383202 20:50170905-50170927 CAGAGGGAACGAAAGGAAGAGGG + Intergenic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1174746976 20:53073030-53073052 AAGGAGGAATGGATGGAGGAAGG - Intronic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175357029 20:58376600-58376622 CAGTCAGGATGGATGGAAGAAGG - Intergenic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1175893858 20:62327462-62327484 AGGTGGGACTGGATGCAAGATGG - Intronic
1177004746 21:15657609-15657631 TGGGGGGAATGGATGGAAGGGGG - Intergenic
1177004746 21:15657609-15657631 TGGGGGGAATGGATGGAAGGGGG - Intergenic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1178689322 21:34738265-34738287 AAGTGGGAAAGGCAGGAAGAAGG - Intergenic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179032840 21:37735490-37735512 CAGTGAGAAGGGCTGGAGGAGGG - Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179114196 21:38475220-38475242 CAGTGGCAAGGGATGGGAGATGG + Intronic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179179868 21:39036061-39036083 CAGGAGGCATGGATGGAAGAGGG - Intergenic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1179373405 21:40827966-40827988 CAGAGGAATTGGATGGAAGAAGG + Intronic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180065580 21:45410487-45410509 CAGTGGGAACGGCAGGAGGAGGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181387817 22:22558141-22558163 CAGTGGGGGGGGATGGAGGAAGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1181508021 22:23374808-23374830 CAGTGGTCATGGATAGAGGAGGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184240872 22:43210680-43210702 CAGTGGGAACTGATGAACGATGG + Intronic
1184240872 22:43210680-43210702 CAGTGGGAACTGATGAACGATGG + Intronic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1184912844 22:47547667-47547689 CAGTGAGTAGGTATGGAAGAAGG + Intergenic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
1185193336 22:49452606-49452628 ATGTGTGAATGGATGGATGATGG + Intronic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950175659 3:10872390-10872412 AAATGGGGATGGAAGGAAGACGG - Intronic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
950375587 3:12569620-12569642 CAGTGGGAGATGATGGAAGTAGG + Intronic
950475070 3:13209909-13209931 CAATGGGAAAGGTTGGAGGATGG - Intergenic
950475070 3:13209909-13209931 CAATGGGAAAGGTTGGAGGATGG - Intergenic
950695833 3:14700606-14700628 CAGTGTCAATGGATGCAACAAGG - Intronic
950695833 3:14700606-14700628 CAGTGTCAATGGATGCAACAAGG - Intronic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
950704167 3:14769755-14769777 TAGGGGCACTGGATGGAAGAGGG + Intronic
951350727 3:21603817-21603839 CAGTAGGCAGGGATGGTAGAAGG + Intronic
951350727 3:21603817-21603839 CAGTAGGCAGGGATGGTAGAAGG + Intronic
952136342 3:30426353-30426375 GAATGGGGGTGGATGGAAGAAGG + Intergenic
952136342 3:30426353-30426375 GAATGGGGGTGGATGGAAGAAGG + Intergenic
953935241 3:47036146-47036168 TATTGGGAATAGGTGGAAGAAGG - Intronic
953935241 3:47036146-47036168 TATTGGGAATAGGTGGAAGAAGG - Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
954886043 3:53874815-53874837 CAGAATGAATGGATGGAAGAAGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
954935391 3:54322098-54322120 CATTGGGAGTGGAAGGAGGAGGG + Intronic
957008734 3:74981237-74981259 GATAGGGAGTGGATGGAAGAAGG - Intergenic
957008734 3:74981237-74981259 GATAGGGAGTGGATGGAAGAAGG - Intergenic
959492750 3:107011224-107011246 CAGTGAGAATGTATAGAAAATGG + Intergenic
959492750 3:107011224-107011246 CAGTGAGAATGTATAGAAAATGG + Intergenic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960622518 3:119650686-119650708 GAGTGAGTGTGGATGGAAGAGGG - Intronic
960763408 3:121097644-121097666 CACTGGGAATGGTTGGATGGTGG - Intronic
960763408 3:121097644-121097666 CACTGGGAATGGTTGGATGGTGG - Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962166590 3:133055660-133055682 CAGTGGGCATGGAAAGAAAAAGG - Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963513807 3:146282330-146282352 AAGTGGGAATTGATAGAAGAAGG + Intergenic
963827482 3:149970853-149970875 CAGTGCGAAGGGCTCGAAGATGG - Exonic
963827482 3:149970853-149970875 CAGTGCGAAGGGCTCGAAGATGG - Exonic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
964242343 3:154611261-154611283 GAGGGGGAAGGGAGGGAAGAAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965382272 3:168004708-168004730 GAGTAGGAATGGAGGGAAGGAGG - Intergenic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
965557073 3:170029472-170029494 CATTGTGAATGGGTTGAAGAAGG + Intergenic
965763883 3:172109705-172109727 GACTGGGAAGGGATGGAGGAAGG - Intronic
965763883 3:172109705-172109727 GACTGGGAAGGGATGGAGGAAGG - Intronic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966086748 3:176077632-176077654 AATTGGGAAGGGAGGGAAGAAGG + Intergenic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966431257 3:179833172-179833194 CAGTGGGAATGGAGAGGAAAGGG + Intronic
966446985 3:180011748-180011770 CAGGAGGAAGGGATGAAAGAGGG - Intronic
966446985 3:180011748-180011770 CAGGAGGAAGGGATGAAAGAGGG - Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
967972999 3:195012875-195012897 CAGTGGGAGAGGATGGAGGAGGG + Intergenic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969360496 4:6660360-6660382 CACTGGGACTGGGAGGAAGAAGG + Intergenic
969383186 4:6821368-6821390 CAGGGGGAAAGGGTGGGAGACGG - Intronic
969383186 4:6821368-6821390 CAGGGGGAAAGGGTGGGAGACGG - Intronic
969827812 4:9771916-9771938 GCGTTGGAATGGGTGGAAGAGGG + Intronic
969827812 4:9771916-9771938 GCGTTGGAATGGGTGGAAGAGGG + Intronic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
970820267 4:20204175-20204197 CAGTAGGACTGGATGGAAGAAGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971455265 4:26838118-26838140 CAGAGGAAATGGATGGGAAAGGG - Intergenic
971455265 4:26838118-26838140 CAGAGGAAATGGATGGGAAAGGG - Intergenic
972576230 4:40354409-40354431 CAAGGGGAGTGAATGGAAGAAGG + Exonic
972576230 4:40354409-40354431 CAAGGGGAGTGAATGGAAGAAGG + Exonic
973835547 4:54805914-54805936 CAGGGGGAATGGCTGGGAAAGGG + Intergenic
973835547 4:54805914-54805936 CAGGGGGAATGGCTGGGAAAGGG + Intergenic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974564600 4:63566895-63566917 CCTTGGGAAAGGATGGGAGAAGG - Intergenic
974564600 4:63566895-63566917 CCTTGGGAAAGGATGGGAGAAGG - Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
974660973 4:64888406-64888428 CAGTGGGACTGGAGGCAGGAGGG + Intergenic
977848698 4:101798203-101798225 GAATGGGAATGAGTGGAAGAAGG + Intronic
977848698 4:101798203-101798225 GAATGGGAATGAGTGGAAGAAGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978010323 4:103674406-103674428 CTGTGGAAATAGATGGAAGTAGG + Intronic
978940413 4:114429382-114429404 CAGTGAGAAGGGATGGATCAGGG + Intergenic
978940413 4:114429382-114429404 CAGTGAGAAGGGATGGATCAGGG + Intergenic
978972912 4:114832599-114832621 CAGTGGGAATGAATGTGGGATGG - Intronic
978972912 4:114832599-114832621 CAGTGGGAATGAATGTGGGATGG - Intronic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
978978790 4:114915841-114915863 GAGAGGGAAGGGAAGGAAGAGGG + Intronic
979032140 4:115663100-115663122 CAGTGGGAATGGTTTGTACAAGG + Intergenic
979032140 4:115663100-115663122 CAGTGGGAATGGTTTGTACAAGG + Intergenic
979202270 4:117992867-117992889 CAGTGGGGAAGGGTGGGAGAAGG + Intergenic
979202270 4:117992867-117992889 CAGTGGGGAAGGGTGGGAGAAGG + Intergenic
979435272 4:120680794-120680816 CAGTGGGGAAGGCTGGAAGGAGG + Intergenic
979435272 4:120680794-120680816 CAGTGGGGAAGGCTGGAAGGAGG + Intergenic
980263512 4:130485107-130485129 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
980263512 4:130485107-130485129 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
982081351 4:151793331-151793353 CAGAGGAAGTGGATCGAAGAAGG + Intergenic
982081351 4:151793331-151793353 CAGAGGAAGTGGATCGAAGAAGG + Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
982104123 4:151997100-151997122 CATTGGGAATGGAAAGAGGAAGG + Intergenic
983046941 4:162998894-162998916 CAATGGGAATGTATGGCACAGGG - Intergenic
983046941 4:162998894-162998916 CAATGGGAATGTATGGCACAGGG - Intergenic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983539332 4:168891608-168891630 AAGTGGGAAAGAAAGGAAGAAGG + Intronic
983855861 4:172643579-172643601 TAGTGGGAATTGTTGGAAGCTGG - Intronic
983855861 4:172643579-172643601 TAGTGGGAATTGTTGGAAGCTGG - Intronic
983923019 4:173367944-173367966 CACTGGGAATGGCTTAAAGATGG - Intergenic
983923019 4:173367944-173367966 CACTGGGAATGGCTTAAAGATGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984261068 4:177444179-177444201 TAGTGGGAATGGCTGATAGAAGG + Intergenic
984261068 4:177444179-177444201 TAGTGGGAATGGCTGATAGAAGG + Intergenic
984632226 4:182073292-182073314 CAGTGGGAAGTGATGGATCACGG - Intergenic
984632226 4:182073292-182073314 CAGTGGGAAGTGATGGATCACGG - Intergenic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
984646273 4:182223948-182223970 CAGAGGCAATGGAAGAAAGATGG + Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
987619513 5:20322106-20322128 CAGAGTGCATGGTTGGAAGATGG + Intronic
987619513 5:20322106-20322128 CAGAGTGCATGGTTGGAAGATGG + Intronic
987906773 5:24088176-24088198 CAGTGGGAATGAATGGATTGGGG - Intronic
987906773 5:24088176-24088198 CAGTGGGAATGAATGGATTGGGG - Intronic
988323836 5:29737172-29737194 CATTGAGCGTGGATGGAAGACGG + Intergenic
988323836 5:29737172-29737194 CATTGAGCGTGGATGGAAGACGG + Intergenic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
988918489 5:35919858-35919880 CAGTGGGTATGGGGTGAAGATGG + Intronic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
990957581 5:61359153-61359175 CAGTGGGAGTGGATCAGAGAGGG + Intronic
990957581 5:61359153-61359175 CAGTGGGAGTGGATCAGAGAGGG + Intronic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
991311176 5:65244227-65244249 TATTGGGAATGGTTGGAAAAAGG + Intronic
991311176 5:65244227-65244249 TATTGGGAATGGTTGGAAAAAGG + Intronic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992175612 5:74146299-74146321 CAGTCAGAAGGGAAGGAAGATGG - Intergenic
992630274 5:78673300-78673322 CAGTGGGAAGGGCTTGAAAAAGG - Intronic
992630274 5:78673300-78673322 CAGTGGGAAGGGCTTGAAAAAGG - Intronic
993010835 5:82480503-82480525 CAGGGAGAAAGGATGGGAGAGGG + Intergenic
993010835 5:82480503-82480525 CAGGGAGAAAGGATGGGAGAGGG + Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993379000 5:87184041-87184063 CAGTAGGAATGAATGGAAATTGG - Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993602242 5:89941520-89941542 CAGTGGTAAAGGAAGGGAGAGGG + Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
993621457 5:90173112-90173134 CAGTGGAAATGGAAGGAACCAGG - Intergenic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994425582 5:99581237-99581259 CAGGGGAAATTGATAGAAGAAGG - Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
994435759 5:99731004-99731026 CAGGGGAAATTGATAGAAGAAGG + Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
994581692 5:101650702-101650724 CAGTGGAATTATATGGAAGAAGG - Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995459355 5:112386903-112386925 GAGTGGGGATGGATAGCAGAAGG - Intronic
995493623 5:112719100-112719122 AAGTGGGACTGTATGGAGGAGGG + Intronic
995493623 5:112719100-112719122 AAGTGGGACTGTATGGAGGAGGG + Intronic
995624000 5:114056761-114056783 AAGGGGGGAAGGATGGAAGACGG - Intergenic
995624000 5:114056761-114056783 AAGGGGGGAAGGATGGAAGACGG - Intergenic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996119084 5:119650971-119650993 CAGTGTGAATGGAAGTCAGATGG + Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
996209167 5:120783853-120783875 TAGTGGGAATGGGGGGAAAAAGG - Intergenic
997267824 5:132506659-132506681 CTCTTGGAATGAATGGAAGATGG + Intergenic
997267824 5:132506659-132506681 CTCTTGGAATGAATGGAAGATGG + Intergenic
998131125 5:139651459-139651481 CAGTGGGAACCCATGGAACATGG - Intronic
998131125 5:139651459-139651481 CAGTGGGAACCCATGGAACATGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998513555 5:142733526-142733548 CAGTGGGAAGGGATTAAACAAGG + Intergenic
998513555 5:142733526-142733548 CAGTGGGAAGGGATTAAACAAGG + Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998708352 5:144791477-144791499 CCGGGGGAAGGGAAGGAAGAGGG - Intergenic
998818534 5:146037023-146037045 CAGTTGGACTGGATTTAAGAAGG - Intronic
998818534 5:146037023-146037045 CAGTTGGACTGGATTTAAGAAGG - Intronic
999800747 5:155031789-155031811 CAGAGGGAAAGGATGGAAACGGG - Intergenic
999800747 5:155031789-155031811 CAGAGGGAAAGGATGGAAACGGG - Intergenic
999823522 5:155252222-155252244 CAGAGGCCATGGATGGAGGAAGG + Intergenic
999823522 5:155252222-155252244 CAGAGGCCATGGATGGAGGAAGG + Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1000695173 5:164371689-164371711 CAGTGGGACAAGATGGAAGGGGG + Intergenic
1001406353 5:171480131-171480153 GAGGGGGAATGAATGAAAGAGGG + Intergenic
1001406353 5:171480131-171480153 GAGGGGGAATGAATGAAAGAGGG + Intergenic
1001551595 5:172606400-172606422 CAGTGAGGATGTCTGGAAGAAGG - Intergenic
1001551595 5:172606400-172606422 CAGTGAGGATGTCTGGAAGAAGG - Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1001701722 5:173711651-173711673 ATGGGTGAATGGATGGAAGAGGG + Intergenic
1002990988 6:2238553-2238575 CAGTGGGAAGGAATGAGAGAAGG - Intronic
1002990988 6:2238553-2238575 CAGTGGGAAGGAATGAGAGAAGG - Intronic
1003763814 6:9213597-9213619 CATTGGGATTGGATGGAAAGTGG + Intergenic
1003763814 6:9213597-9213619 CATTGGGATTGGATGGAAAGTGG + Intergenic
1003807044 6:9737109-9737131 CAGTGGGAATGGATGTTCTATGG - Intronic
1003807044 6:9737109-9737131 CAGTGGGAATGGATGTTCTATGG - Intronic
1003807052 6:9737142-9737164 CAGTGGGAATGGATGTTCTATGG - Intronic
1003807052 6:9737142-9737164 CAGTGGGAATGGATGTTCTATGG - Intronic
1003807064 6:9737208-9737230 CAGTGGGAATGGATGTTCTATGG - Intronic
1003807064 6:9737208-9737230 CAGTGGGAATGGATGTTCTATGG - Intronic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004375172 6:15084840-15084862 CATTGGGAGAGGATGGAGGATGG + Intergenic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1004571615 6:16851265-16851287 CACTGTGTATGCATGGAAGAGGG + Intergenic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006970195 6:38035975-38035997 GAGAGGTAATGGATGGAAGCTGG - Intronic
1006970195 6:38035975-38035997 GAGAGGTAATGGATGGAAGCTGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1011524736 6:88252281-88252303 TTGGGTGAATGGATGGAAGAAGG + Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1012310475 6:97718309-97718331 CAGTAGGAATGGACAAAAGAGGG + Intergenic
1012505621 6:99943113-99943135 CAGTCGAAATGGTTGGACGAGGG + Exonic
1012505621 6:99943113-99943135 CAGTCGAAATGGTTGGACGAGGG + Exonic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013420544 6:109962735-109962757 CATTGAGAATGGAAGGAAGGTGG + Intergenic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1013525364 6:110969066-110969088 CAGTGGAAATGGAAGACAGAAGG - Intergenic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1014431687 6:121378422-121378444 CAGTAGGAAAGGAAGGAATAGGG - Intergenic
1014431687 6:121378422-121378444 CAGTAGGAAAGGAAGGAATAGGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1016446078 6:144133247-144133269 CAGTGTGAATGGAGGGAAAGTGG - Intergenic
1017366326 6:153645068-153645090 CAGTGGGAAATAATGGTAGATGG + Intergenic
1017366326 6:153645068-153645090 CAGTGGGAAATAATGGTAGATGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1017587081 6:155938269-155938291 AAGTGGGATTGGAGGGAAGGTGG + Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020224442 7:6269070-6269092 CAGGAGGAATGGCAGGAAGAAGG - Intronic
1020459562 7:8413195-8413217 TATTGAGAATGGACGGAAGAAGG + Intergenic
1020459562 7:8413195-8413217 TATTGAGAATGGACGGAAGAAGG + Intergenic
1020724257 7:11789388-11789410 CAGAGGGCAAGAATGGAAGAAGG + Intronic
1020724257 7:11789388-11789410 CAGAGGGCAAGAATGGAAGAAGG + Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1022162998 7:27730859-27730881 CAGTGTGAAGGGATGGTAAAGGG + Intergenic
1023179589 7:37468770-37468792 CAGAGTGAATGGATTGCAGAGGG - Intergenic
1023179589 7:37468770-37468792 CAGAGTGAATGGATTGCAGAGGG - Intergenic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1023689539 7:42772193-42772215 CAGTGGGAATGGAGGCAGCAAGG - Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1024720604 7:52133769-52133791 GAGTGGGTGTGGATTGAAGAAGG + Intergenic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026028366 7:66766681-66766703 CAGTGGGAATGGAAAGACGACGG - Intronic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1026337126 7:69404145-69404167 CAGGGGGAAAGGATGGGAAAGGG + Intergenic
1026903302 7:74048770-74048792 GAATGGGAATGGATGGAGGGAGG - Intronic
1026903302 7:74048770-74048792 GAATGGGAATGGATGGAGGGAGG - Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1027991522 7:85369064-85369086 CATTGAGAGTGGATGGAAGGAGG - Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1029924474 7:104301159-104301181 CAGGAGCAATGGATGGAACATGG + Intergenic
1029924474 7:104301159-104301181 CAGGAGCAATGGATGGAACATGG + Intergenic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1029942262 7:104492876-104492898 GAGTGGCAATGGATGGTGGAAGG - Intronic
1030087125 7:105825926-105825948 CATAGGGAAGGGATGGAGGAAGG + Intronic
1030087125 7:105825926-105825948 CATAGGGAAGGGATGGAGGAAGG + Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1031938992 7:127767219-127767241 CAGTGGAAAGGGATGGGGGAAGG - Intronic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032499291 7:132388009-132388031 CGGTGGGAATTGATTGAAGCTGG - Intronic
1032900141 7:136297809-136297831 CAGTTGGAGTGGGTTGAAGAGGG + Intergenic
1032900141 7:136297809-136297831 CAGTTGGAGTGGGTTGAAGAGGG + Intergenic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1033414034 7:141146791-141146813 GGGTGGGAAAGGATGGTAGAAGG - Intronic
1034709253 7:153176444-153176466 CAGTGGTAATGAATGCAAAATGG + Intergenic
1034709253 7:153176444-153176466 CAGTGGTAATGAATGCAAAATGG + Intergenic
1034860071 7:154587339-154587361 CAGTGGGAATGGTTGGGGGGAGG - Intronic
1034860071 7:154587339-154587361 CAGTGGGAATGGTTGGGGGGAGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1035695816 8:1594985-1595007 CAGTGTGTATGGATTCAAGATGG - Intronic
1035695816 8:1594985-1595007 CAGTGTGTATGGATTCAAGATGG - Intronic
1036962574 8:13261351-13261373 GAATGGGAAAGGATAGAAGAAGG + Intronic
1036962574 8:13261351-13261373 GAATGGGAAAGGATAGAAGAAGG + Intronic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037305544 8:17499394-17499416 GAGAGAGAATGGAGGGAAGAGGG - Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1037950244 8:23014844-23014866 GAATGGGAAGGGGTGGAAGATGG + Intronic
1037950244 8:23014844-23014866 GAATGGGAAGGGGTGGAAGATGG + Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1037951918 8:23024141-23024163 CAGCAGGAATGGAGGGAATAGGG - Intronic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038688444 8:29739777-29739799 CAGTGGGGGTTGAAGGAAGAGGG + Intergenic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1038881853 8:31623316-31623338 AAGTGGGAATGAAAGGATGAAGG + Intergenic
1039027622 8:33275095-33275117 CAGTGGGAAGGGCTGGGTGATGG - Intergenic
1039027622 8:33275095-33275117 CAGTGGGAAGGGCTGGGTGATGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1039485356 8:37905481-37905503 CAGTGGGAAGGGAAGGAAAGGGG - Intergenic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1041944264 8:63424180-63424202 CACTGGGACTGGTTGGAAGGTGG + Intergenic
1042104796 8:65314958-65314980 CAGAGGGAATGTATGTAGGAGGG + Intergenic
1042104796 8:65314958-65314980 CAGAGGGAATGTATGTAGGAGGG + Intergenic
1043383157 8:79724087-79724109 CCAAGGGACTGGATGGAAGAAGG - Intergenic
1043383157 8:79724087-79724109 CCAAGGGACTGGATGGAAGAAGG - Intergenic
1043459172 8:80442070-80442092 GAGTGGAAATGGATGGAATTAGG + Intergenic
1043459172 8:80442070-80442092 GAGTGGAAATGGATGGAATTAGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1043630588 8:82326511-82326533 AATTGGGATTGGATGGTAGAAGG + Intergenic
1043630588 8:82326511-82326533 AATTGGGATTGGATGGTAGAAGG + Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044370343 8:91402899-91402921 GAGGGGGAATGGATGGGGGAGGG + Intergenic
1044370343 8:91402899-91402921 GAGGGGGAATGGATGGGGGAGGG + Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1046194797 8:110847432-110847454 CAGTGGGGAGGGGTGGATGAAGG + Intergenic
1046194797 8:110847432-110847454 CAGTGGGGAGGGGTGGATGAAGG + Intergenic
1046528537 8:115413809-115413831 CAATGAGAAAGAATGGAAGATGG - Exonic
1046528537 8:115413809-115413831 CAATGAGAAAGAATGGAAGATGG - Exonic
1046854793 8:119018934-119018956 AAATGGGAATGGAAGAAAGAGGG - Intronic
1046854793 8:119018934-119018956 AAATGGGAATGGAAGAAAGAGGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047954438 8:129962668-129962690 CAGAGGGGAGGGATAGAAGAGGG - Intronic
1047954438 8:129962668-129962690 CAGAGGGGAGGGATAGAAGAGGG - Intronic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049695822 8:143983857-143983879 GAGTTGGAATGGATGAAAGATGG + Intronic
1049695822 8:143983857-143983879 GAGTTGGAATGGATGAAAGATGG + Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050630108 9:7549650-7549672 CAGTGAGAAAGGATGGATCAGGG - Intergenic
1050630108 9:7549650-7549672 CAGTGAGAAAGGATGGATCAGGG - Intergenic
1050973066 9:11901683-11901705 GGAAGGGAATGGATGGAAGAGGG - Intergenic
1050973066 9:11901683-11901705 GGAAGGGAATGGATGGAAGAGGG - Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1051917976 9:22230356-22230378 CAGTGGGGAGGGATGGATGCAGG - Intergenic
1051917976 9:22230356-22230378 CAGTGGGGAGGGATGGATGCAGG - Intergenic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052039268 9:23719745-23719767 CACTGGGTAGGGAAGGAAGAGGG + Intronic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1052518917 9:29518177-29518199 GAGTGGGAAGGGAGGGGAGATGG - Intergenic
1053039391 9:34856989-34857011 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1053039391 9:34856989-34857011 CAGTGAGAAGGGATGGATCAGGG + Intergenic
1055131287 9:72778301-72778323 CATTGAGAGTGGATGGAGGAAGG + Intronic
1055131287 9:72778301-72778323 CATTGAGAGTGGATGGAGGAAGG + Intronic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055337987 9:75252116-75252138 CATTGGGAGTGAATGGAAGGAGG - Intergenic
1055337987 9:75252116-75252138 CATTGGGAGTGAATGGAAGGAGG - Intergenic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055343336 9:75308702-75308724 CAGTGGGGAGGGATGGAACAGGG + Intergenic
1055661952 9:78512703-78512725 CAGTGGGTATGGATGGGTGTGGG - Intergenic
1055661952 9:78512703-78512725 CAGTGGGTATGGATGGGTGTGGG - Intergenic
1055732235 9:79289983-79290005 AAGTGGGAATGGATGAAGCAGGG + Intergenic
1055732235 9:79289983-79290005 AAGTGGGAATGGATGAAGCAGGG + Intergenic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1056136269 9:83632189-83632211 GAGTGGGAATGGCGGGGAGATGG - Intronic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1057749945 9:97784341-97784363 TAGTGGGAATGGCTGGAAGGCGG - Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060351561 9:122865730-122865752 CAATGGGAATAGATTGAAAAAGG + Intronic
1060351561 9:122865730-122865752 CAATGGGAATAGATTGAAAAAGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1061947352 9:133916148-133916170 CAGGGAGAATGGAGGGAAGGAGG + Intronic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1062257608 9:135635821-135635843 ACGTGGGAATGGATTGAAGCTGG - Intronic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1185689395 X:2140706-2140728 CAGTGGGAGAGGCTGGAAAAAGG + Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186163865 X:6806070-6806092 CAGTGGGAATGGATGGAGATAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1187030327 X:15480582-15480604 GAGTGGGAAGGGATCAAAGAAGG + Intronic
1187030327 X:15480582-15480604 GAGTGGGAAGGGATCAAAGAAGG + Intronic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1188056287 X:25544481-25544503 CAGTAGGAAGGGATGGAGGAAGG - Intergenic
1188105202 X:26140867-26140889 CAGTAATAATGTATGGAAGATGG + Intergenic
1188105202 X:26140867-26140889 CAGTAATAATGTATGGAAGATGG + Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188697722 X:33216445-33216467 GAGGGGGAATGGAGGGAAGCGGG + Intronic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1188970788 X:36613095-36613117 CAATGAGACTGGATAGAAGAGGG + Intergenic
1188997151 X:36899448-36899470 AACTGGGAATGGATGGATAACGG + Intergenic
1188997151 X:36899448-36899470 AACTGGGAATGGATGGATAACGG + Intergenic
1189678199 X:43486286-43486308 CACTGAGAATGGATGGAGGGAGG + Intergenic
1189678199 X:43486286-43486308 CACTGAGAATGGATGGAGGGAGG + Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1190259802 X:48790729-48790751 GAGAGAGAATGGAAGGAAGAAGG + Intronic
1190259802 X:48790729-48790751 GAGAGAGAATGGAAGGAAGAAGG + Intronic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1190787939 X:53671123-53671145 CAGGGGGAAAGGATGGGAAAGGG + Intronic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1192315803 X:70050374-70050396 CAATGGGATTGGAGGGCAGAGGG + Intergenic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195172986 X:102286756-102286778 CATTGAAAATGGATGGAGGAAGG - Intergenic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195185880 X:102400339-102400361 CATTGAAAATGGATGGAGGAAGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196218340 X:113081845-113081867 CAGTGGGAAAGGGTGGGAAAAGG - Intergenic
1196218340 X:113081845-113081867 CAGTGGGAAAGGGTGGGAAAAGG - Intergenic
1196549456 X:117005377-117005399 AAGAGGAAATGGATGAAAGAGGG + Intergenic
1196549456 X:117005377-117005399 AAGAGGAAATGGATGAAAGAGGG + Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1196938075 X:120749383-120749405 AAGTGGGAGGGGAAGGAAGAGGG + Intergenic
1197708543 X:129650660-129650682 CAGTAAGTATGGATGGAACAAGG + Intronic
1197708543 X:129650660-129650682 CAGTAAGTATGGATGGAACAAGG + Intronic
1197779139 X:130142341-130142363 TAGCGGGATTGGATTGAAGAGGG - Intronic
1197779139 X:130142341-130142363 TAGCGGGATTGGATTGAAGAGGG - Intronic
1197904357 X:131408700-131408722 CAGAGGGATTGGTTGAAAGATGG + Intergenic
1197904357 X:131408700-131408722 CAGAGGGATTGGTTGAAAGATGG + Intergenic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1198089043 X:133309554-133309576 CATTGGGAATGGAATGCAGAAGG - Intronic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199264872 X:145818178-145818200 CAGTGGGGATTGAGGGTAGAGGG - Exonic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1199924484 X:152448581-152448603 CAGTGGGACTGGGTGGAAAGGGG - Intronic
1200098862 X:153678502-153678524 CTACGGCAATGGATGGAAGACGG - Intronic
1200098862 X:153678502-153678524 CTACGGCAATGGATGGAAGACGG - Intronic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic