ID: 974431923

View in Genome Browser
Species Human (GRCh38)
Location 4:61809570-61809592
Sequence GCAGCTAGCAATTTTAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 214}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974431923 Original CRISPR GCAGCTAGCAATTTTAAATA GGG (reversed) Intronic
905730629 1:40296896-40296918 CTGGCCAGCAATTTTAAATAGGG + Intergenic
907797617 1:57733183-57733205 GCAAGTTGCAATTTTAAATAGGG - Intronic
907940039 1:59078726-59078748 ACAGCTAGCAATTATATGTAAGG + Intergenic
909453318 1:75823014-75823036 GAAGCTAGAAACTTAAAATAAGG + Intronic
910199304 1:84682105-84682127 GCAGCTCACAAAGTTAAATACGG + Intronic
910775631 1:90871965-90871987 AGGGCTTGCAATTTTAAATAAGG + Intergenic
911138669 1:94472210-94472232 GCAGCTATAAATTTAAAAAATGG - Intronic
911556516 1:99351929-99351951 GTGGTTTGCAATTTTAAATAGGG - Intergenic
912052445 1:105546340-105546362 TCAGCTATCAATTTTGCATAAGG + Intergenic
912925386 1:113908305-113908327 CCAGGTTGCAATTTTAAATAAGG - Intronic
913355374 1:117915482-117915504 TCAGCTGGAAATTTTAAATATGG + Intronic
916577020 1:166076488-166076510 GGAGGTTGCAATTTTAAATATGG - Intronic
917411238 1:174761964-174761986 GTAGGTTGCAATGTTAAATAGGG + Intronic
917707216 1:177646787-177646809 TCTGCTACCAATTTTAACTAGGG + Intergenic
917804081 1:178597978-178598000 GCAGCTACCAATTTTAAAAAGGG - Intergenic
919148661 1:193667103-193667125 GTAGATTGCAATTTCAAATAGGG - Intergenic
922957673 1:229617768-229617790 GTTTCTAGCAATCTTAAATATGG - Intronic
1063713607 10:8505583-8505605 GCAACTGTCATTTTTAAATATGG + Intergenic
1064434166 10:15296440-15296462 GCAGCTAGAAATTGCATATAAGG - Intronic
1066003993 10:31130432-31130454 GCAGCAACCAATTTTAAATCTGG - Intergenic
1067132243 10:43575143-43575165 GTACTTTGCAATTTTAAATAGGG + Intergenic
1068665078 10:59665343-59665365 CCAGGTAGCTATTTTAAGTAAGG - Intronic
1069019358 10:63467995-63468017 ACAGCTGGCAGTTTTATATAAGG - Intergenic
1069026286 10:63545901-63545923 GTAACTTGCAATTTTAAATAAGG + Intronic
1069281547 10:66660757-66660779 GTAGAGATCAATTTTAAATAGGG - Intronic
1069956439 10:72054702-72054724 GAATTTAGCAATTTTAAAAAGGG - Intergenic
1070118284 10:73550416-73550438 GGAGCTTACAATTTTAAAGAGGG - Intronic
1071100122 10:82027017-82027039 GCAGCTAATGATTTTAAATAAGG + Intronic
1071361671 10:84852227-84852249 GCAGGTTGCAATTTAAAATAGGG - Intergenic
1071411657 10:85402879-85402901 GCAGCTGGCAACATTCAATATGG - Intergenic
1072301748 10:94068523-94068545 GCAAATAGCCATTTTATATAAGG + Intronic
1074332940 10:112537808-112537830 GCAGATAGAAATTTTAAAACAGG - Intronic
1075193312 10:120331132-120331154 GCAGCTTCCCATTTAAAATAGGG - Intergenic
1076279250 10:129231616-129231638 GCAGTCAACATTTTTAAATATGG - Intergenic
1079284905 11:19119576-19119598 AAGGCTTGCAATTTTAAATACGG - Intronic
1079671382 11:23175565-23175587 GAAGGTTGCAATTTTAAATTGGG + Intergenic
1083123820 11:60543073-60543095 GCAGAAAGGAACTTTAAATAAGG - Intergenic
1085027445 11:73244844-73244866 GAAGGTTGCAATTTTAAATAGGG + Intergenic
1086109696 11:83186606-83186628 GCCACTAGAAATTTTAAACAGGG + Exonic
1086460458 11:87000528-87000550 TCAGCTAGCAATGTCAGATAAGG - Intergenic
1087204688 11:95381582-95381604 ACAGGTAGCAATTCTCAATATGG + Intergenic
1088985773 11:114906646-114906668 TCAGGTAGCAATTTCAAATCTGG + Intergenic
1089153365 11:116382334-116382356 GAAGGTTGCTATTTTAAATAGGG + Intergenic
1089231260 11:116978807-116978829 GCAGTTAGAAATAATAAATACGG - Intronic
1090079878 11:123605091-123605113 GCAGCCAGGAATTTTACATGGGG + Intronic
1090979566 11:131706281-131706303 GGATATAACAATTTTAAATATGG + Intronic
1091101382 11:132876951-132876973 CCAGGGAGTAATTTTAAATAAGG + Intronic
1091961227 12:4696316-4696338 TCATTTAGCAAATTTAAATAAGG - Intronic
1095583514 12:43826404-43826426 CCAGCTGGCAATTGGAAATATGG - Intergenic
1096636073 12:52960474-52960496 GCAGATTGCAGTTTTAAGTAGGG + Intergenic
1097742314 12:63257809-63257831 GAAGGTTGGAATTTTAAATAGGG - Intergenic
1098768381 12:74519083-74519105 GCAGGCTGCAATTTTAAATAGGG + Intergenic
1099152834 12:79136820-79136842 GCAGTGATCAATTTTAAATATGG + Intronic
1099240867 12:80136719-80136741 GAAGATAGCAATTTTAGACAAGG - Intergenic
1099916859 12:88905550-88905572 ACAGGTATCAATTTTAAAGAAGG + Intergenic
1100508936 12:95249477-95249499 GCTGCCAGAAATTTTAAATCTGG + Intronic
1100977286 12:100135603-100135625 GGAGTTTGCAATTTTAAATCTGG - Intronic
1101769296 12:107733688-107733710 GCAGCTAGTAAGTTTAAAGCAGG - Exonic
1103718647 12:122961490-122961512 CCAGAGATCAATTTTAAATAGGG + Intronic
1106595818 13:31135470-31135492 GCAGCTAGAAATTATAAAGTAGG + Exonic
1108522177 13:51256387-51256409 GCAACTAACGGTTTTAAATAAGG + Intronic
1109157753 13:58932043-58932065 GCAGCTCCCAATTATAAATCTGG - Intergenic
1109260626 13:60141847-60141869 GCAGGTTGCAATTTTAAACATGG + Intronic
1109743374 13:66586034-66586056 ATAGCTAGAACTTTTAAATAAGG - Intronic
1109966333 13:69702258-69702280 GCATATAGCAATTATAATTATGG - Intronic
1110799765 13:79681344-79681366 GCAGCTTGCAATTTGAAACAGGG - Intergenic
1110854924 13:80286098-80286120 GCAGATAGAAAATTTAAAAATGG + Intergenic
1111508463 13:89228005-89228027 TCACGTAGTAATTTTAAATAGGG + Intergenic
1111825475 13:93262314-93262336 GGAGAGAGCAATTTTAAAAATGG + Intronic
1112469324 13:99673462-99673484 GCAGGATGCTATTTTAAATAGGG + Intronic
1112757721 13:102657291-102657313 GCTGTTAATAATTTTAAATACGG - Intronic
1112912482 13:104505119-104505141 GTAGTAACCAATTTTAAATAGGG + Intergenic
1115457729 14:33624041-33624063 GAAGTTTGCAATTTTAAATGTGG - Intronic
1117828698 14:59729033-59729055 TGAGTTTGCAATTTTAAATAGGG + Intronic
1118936309 14:70291904-70291926 GCAGGTTACAATTTTAAATAGGG - Intergenic
1118947688 14:70402928-70402950 GCAGCTAGAAATTTTTACAATGG + Intronic
1120159294 14:81128823-81128845 GCAGTTTGCAAACTTAAATAGGG - Intronic
1120376663 14:83717109-83717131 GCAGCAAGCATTTTTACTTAGGG + Intergenic
1121544210 14:94751598-94751620 GCAGCTGGCATTGATAAATATGG + Intergenic
1125115878 15:36091152-36091174 GCAGCCAACAATTATAATTAAGG - Intergenic
1125230512 15:37449866-37449888 GCTGTTACCAATTTTAAATTTGG - Intergenic
1127695784 15:61445580-61445602 ACAGATAGCAGTTTTAAATGTGG - Intergenic
1128395787 15:67223991-67224013 GTAGATTGCAATGTTAAATAAGG - Intronic
1129595753 15:76962839-76962861 GCAGGTTGCAGTATTAAATAGGG - Intergenic
1129618503 15:77120720-77120742 GCCGCTAGGAAATTTAAATAAGG - Intronic
1130631311 15:85571591-85571613 GAAGGTTGCAATTTTAAATGTGG - Intronic
1130693629 15:86108128-86108150 GCAACCAGCAAATTAAAATAAGG + Intergenic
1134672322 16:16064954-16064976 GCGGCTTGCAGTTTTAAGTAGGG + Intronic
1135093763 16:19544604-19544626 GCAGATAACTATTTTATATAAGG + Intronic
1135506087 16:23037635-23037657 GTTGGTTGCAATTTTAAATAGGG - Intergenic
1137475151 16:48801420-48801442 ACAGGTTGCAATTTTAAATAGGG - Intergenic
1144411461 17:15006109-15006131 GTAGTTAGCCACTTTAAATAAGG + Intergenic
1147924312 17:43937376-43937398 CCAGGTTGCAATTATAAATAGGG + Intergenic
1150963332 17:69938780-69938802 GTAGCTAGCAAAGTTCAATATGG - Intergenic
1154041442 18:10859944-10859966 GCAGCTAGGAAGTTTAAAGTGGG + Intronic
1154261909 18:12842459-12842481 GCAGGTTGCAATTCTAAACAGGG + Intronic
1155959588 18:31982834-31982856 CCAGCTAGTGTTTTTAAATAAGG + Intergenic
1157302036 18:46486065-46486087 TCAGGTAGCAATTTTAATTAGGG - Intronic
1159325737 18:66914587-66914609 TCAGCTACCAATTTTTAAGAAGG + Intergenic
1159753883 18:72339091-72339113 GCTGGTAGCAATATAAAATAGGG - Intergenic
1161625362 19:5323454-5323476 GCAGGCTGCAAGTTTAAATAGGG + Intronic
1162730695 19:12716723-12716745 GAAGGTAGCAACTTTAAATTGGG + Intronic
1164879144 19:31715964-31715986 GCATGTGGCAATTTTAAATTAGG - Intergenic
1168558958 19:57367365-57367387 GAAGGTAGCAATTTTACACAAGG - Intronic
928216733 2:29367905-29367927 GTAGCTAGAAAATGTAAATAAGG - Intronic
928903859 2:36350702-36350724 GATGTTAGCAATTTTAAATGAGG + Intergenic
929723916 2:44403224-44403246 GCAGCTAGCATTTTGGAAGATGG + Intronic
931006730 2:57858272-57858294 ACAGCTAGCAAATTTACATTAGG - Intergenic
932109560 2:68984365-68984387 GCAGTTTGCAATTTGTAATAGGG + Intergenic
932906784 2:75762266-75762288 GCAGGTAGCAATTATACAAAAGG - Intergenic
935008883 2:99112508-99112530 ACAGGTTGGAATTTTAAATAGGG + Intronic
935903185 2:107814551-107814573 GGAGTTAGGAATTTAAAATATGG - Intergenic
936954620 2:118012341-118012363 GAAGCTAGTAAATATAAATATGG - Intronic
939247682 2:139646194-139646216 GCAGCATGCAATTTTTAATCTGG - Intergenic
939724800 2:145703889-145703911 GCAGCTATCAAATTTTAATGTGG + Intergenic
940221818 2:151360639-151360661 GTACCTGACAATTTTAAATAAGG - Intronic
941399274 2:165010813-165010835 GCAGGTTGCTATTTCAAATAGGG + Intergenic
942245551 2:174004631-174004653 CCAGGTTGCAATTTTAAATGGGG - Intergenic
942976001 2:182018691-182018713 GCAGCATGCAATTTGAAACATGG + Intronic
943076197 2:183198218-183198240 GGAGATTGTAATTTTAAATAGGG - Intergenic
943142355 2:183998325-183998347 ATAGGTTGCAATTTTAAATAGGG - Intergenic
943164578 2:184304236-184304258 GTAGCTAGCAAATCTAAAAATGG + Intergenic
943561750 2:189472277-189472299 GCAGCTTGTAATTTTAAACAGGG + Intronic
943608898 2:190008900-190008922 GGGGATTGCAATTTTAAATAGGG + Intronic
944580978 2:201132594-201132616 GCATCTTGCAATTCAAAATATGG + Intronic
944642921 2:201746435-201746457 GGAGTTTGCAATTTTAAATAAGG + Intronic
944944998 2:204673660-204673682 GCAGTTTGTATTTTTAAATAAGG - Intronic
945594130 2:211770715-211770737 GCAGCTTGCAATTTCTAGTATGG - Intronic
946487891 2:220118222-220118244 GCAGGTTGCAGTTTTAAATGAGG - Intergenic
947323688 2:228951291-228951313 GCAAATAACACTTTTAAATAAGG + Intronic
947492983 2:230611811-230611833 CCACCTAGCAATTTGAATTAAGG - Intergenic
1173583327 20:44162869-44162891 GCAGATTGCAGTTTTAAACAGGG - Intronic
1173594978 20:44253077-44253099 AAAGGTAGCAATTTTAATTAAGG - Intronic
1174477361 20:50805528-50805550 GCAGCCAGCCCATTTAAATAGGG + Intronic
1177666257 21:24163270-24163292 GCAGTAAGCAATAATAAATATGG - Intergenic
1180915232 22:19481317-19481339 GAATCTAGCAGTTTTTAATATGG + Intronic
1181893070 22:26081797-26081819 CCTGCTAGCAATCTTAAAGAGGG - Intergenic
1182819322 22:33201503-33201525 ACAGCTTGTAATTTTGAATAGGG + Intronic
1182966762 22:34528808-34528830 GCAGGTAGCTTTATTAAATAGGG + Intergenic
1183448796 22:37878846-37878868 ACAGGTTGCAATGTTAAATACGG + Intronic
949218613 3:1601404-1601426 GGGTTTAGCAATTTTAAATAGGG + Intergenic
951679747 3:25282404-25282426 GTGGGTAACAATTTTAAATAGGG - Intronic
955438251 3:58927614-58927636 TCAGCTAGCACTTATAAATCAGG - Intronic
956061154 3:65349524-65349546 ACAACTTGCAATTTTAAATAGGG + Intergenic
957784790 3:84868367-84868389 GCAGAAAACAATTTTAAAAAAGG + Intergenic
960026377 3:113015418-113015440 GAAGATTGCAATTTTAAATAGGG + Intronic
960184155 3:114617901-114617923 TAAGTTTGCAATTTTAAATAGGG - Intronic
962928237 3:140014517-140014539 CCAGGATGCAATTTTAAATAGGG + Intronic
963078900 3:141372977-141372999 GCAGCTAGAAATTAGAAATCAGG - Intronic
963219336 3:142790068-142790090 AGAGTTTGCAATTTTAAATAGGG + Intronic
967033005 3:185625800-185625822 GCATTTATCAATTTTAAAAAGGG - Intronic
967661590 3:192117190-192117212 GCAGTTTGTAGTTTTAAATAAGG - Intergenic
969152891 4:5185602-5185624 GCATCTAGCAATTGTTTATAAGG - Intronic
970322320 4:14886809-14886831 GCAAGTTGCAATTTTAAATTAGG - Intergenic
970393833 4:15645040-15645062 GCAGGCAGAAATTTTAAAGAGGG + Intronic
970420906 4:15905044-15905066 GCAGATTGCCATTTTAAATAGGG - Intergenic
971802809 4:31314838-31314860 GCAGCGAGAAATTGAAAATATGG + Intergenic
973126134 4:46587149-46587171 GCAGCTAAATATTTTAAATTGGG - Intergenic
974431923 4:61809570-61809592 GCAGCTAGCAATTTTAAATAGGG - Intronic
975654605 4:76629143-76629165 GCTGGTTGTAATTTTAAATAAGG + Intronic
976987272 4:91317410-91317432 GTAGCTTATAATTTTAAATAGGG - Intronic
977166292 4:93703171-93703193 TTAGCTAGCAATTTACAATAGGG - Intronic
978924635 4:114228167-114228189 GATGCTAGCATTTTTAAACAAGG - Intergenic
980401500 4:132292080-132292102 GCAGGTTGCAATTTGCAATAAGG - Intergenic
980609559 4:135140218-135140240 GCAGTTAGTAATTCAAAATATGG + Intergenic
980867285 4:138567266-138567288 TCAGATACCAATTTTAATTAAGG - Intergenic
983655856 4:170083698-170083720 GAAACTAGCCATTTTGAATATGG - Intronic
985248780 4:188002280-188002302 GAAGCCTGCAATATTAAATAGGG - Intronic
986567838 5:9132823-9132845 GCAGCTTGCACTTTTACATGAGG + Intronic
987329210 5:16840742-16840764 GGAACTAGTCATTTTAAATATGG - Intronic
989098953 5:37807027-37807049 GCAGCTGGCAATATTCAAGATGG - Intergenic
989427574 5:41314537-41314559 GCAGATTGCATTTTAAAATAGGG + Intronic
989463877 5:41731722-41731744 GCAGATCGCAAATTGAAATATGG - Exonic
991153175 5:63396503-63396525 CTAGCTTGAAATTTTAAATATGG - Intergenic
991524127 5:67537520-67537542 GAAGCGAGAAATTATAAATATGG + Intergenic
992957867 5:81929007-81929029 GCCACTAGCAATTTAAAATGTGG - Intergenic
994536813 5:101041585-101041607 ACAGCTACCAATTTTACCTAGGG - Intergenic
995556964 5:113339674-113339696 GGAACTAGCAATTGTAAATATGG - Intronic
995760275 5:115554997-115555019 GTAGCTAGGAATGTAAAATAAGG - Intergenic
995945152 5:117636116-117636138 GCAATCAGCAATTTTTAATAAGG - Intergenic
997291481 5:132738952-132738974 GAAGGTTGAAATTTTAAATAAGG - Intergenic
998343990 5:141444589-141444611 GCAAAAATCAATTTTAAATAAGG - Intronic
999050419 5:148518146-148518168 GCAGATTGTAATATTAAATAGGG - Intronic
999537129 5:152529541-152529563 GGAGATTGCAATTTTAAACAGGG + Intergenic
1001598433 5:172913586-172913608 GCTGGAAGCAATTTTAAAGAGGG - Intronic
1004019342 6:11762378-11762400 ACATCTAGCAATCTTAAATCTGG - Intronic
1004118053 6:12790470-12790492 TCAGTTTGCAATTTTAAATAGGG - Intronic
1006803751 6:36775640-36775662 GCAGTTGTCAATTTTAGATACGG - Intronic
1008072086 6:47107954-47107976 GCCAGTAGCACTTTTAAATAAGG + Intergenic
1008372188 6:50745373-50745395 GCAGCTAGATATATTAAACAAGG + Intronic
1008722910 6:54379012-54379034 GCAGAAAGCTATTTTTAATAGGG - Intronic
1008763130 6:54878445-54878467 GTAGTTTGCAATTTTAAATAGGG + Intronic
1008781008 6:55104972-55104994 GAAACTATCATTTTTAAATATGG - Intergenic
1009058377 6:58366792-58366814 GCTGCTAAAAATCTTAAATAAGG + Intergenic
1009196357 6:60691163-60691185 GATACTTGCAATTTTAAATAGGG + Intergenic
1009232453 6:61080329-61080351 GCTGCTAAAAATCTTAAATAAGG - Intergenic
1010114148 6:72281775-72281797 GCATATTGCAATTTTAAGTAGGG - Intronic
1012327809 6:97945279-97945301 GCAGTTTTCAATTTTAAATAAGG + Intergenic
1012592283 6:100996794-100996816 GAGGCTAGCAATTTTAGATTGGG - Intergenic
1014112662 6:117637097-117637119 GCTGGTTGCAATTTTAAATAAGG + Intergenic
1015306903 6:131719138-131719160 GCAGTAAGAAACTTTAAATAGGG + Intronic
1016440909 6:144082437-144082459 GCAGATAGGAATTTTTAAGATGG - Intergenic
1016563716 6:145427279-145427301 GAAGATAGCCATTTTAAATAGGG + Intergenic
1021896531 7:25241539-25241561 GAAGTTAGCAATAATAAATAAGG + Intergenic
1022240764 7:28510524-28510546 GCAGCTAGAAGTTTTAAAGGTGG - Intronic
1023367254 7:39476008-39476030 GCAGATAGCAATATTAATTAAGG - Intronic
1023565225 7:41517379-41517401 GAAGGTTGCAATGTTAAATAGGG - Intergenic
1023715347 7:43038150-43038172 GCAGGTTGCAATTTGAAATAGGG - Intergenic
1024497748 7:50067776-50067798 GCAGCTAGTGTTTTAAAATAAGG + Intronic
1026596051 7:71734996-71735018 GCAGGTAGCAATTCAAAGTATGG + Intergenic
1028131666 7:87182652-87182674 GCAGCAAGTAATTTTAATTTAGG + Intronic
1029877302 7:103767867-103767889 GCTGATTGCAATTTTAAATAGGG - Intronic
1030527188 7:110668410-110668432 GCAGCTATCAAATTTTAAAAAGG - Intronic
1031639799 7:124148051-124148073 GCATTTAGCAGTTTTCAATATGG - Intergenic
1032924252 7:136584863-136584885 GCAGGCTGCAATTTTAAGTATGG + Intergenic
1034781969 7:153888680-153888702 CCAGCCAGCAACTTAAAATAAGG - Intronic
1035916229 8:3627267-3627289 GCAGCTAGGTATTTTCAAAATGG - Intronic
1036477238 8:9104391-9104413 ACAGCTAGCAGTTTTCTATATGG + Intronic
1038731909 8:30135518-30135540 GCCATTAGCAATTTGAAATATGG + Intronic
1043035589 8:75194005-75194027 GAAAGTAGCAATTTTAAAAATGG + Intergenic
1043856464 8:85270817-85270839 GCAGGTAGATATTTTTAATAAGG - Intronic
1044048700 8:87472254-87472276 GCAGGCAGAGATTTTAAATAGGG + Intronic
1044300636 8:90579235-90579257 GCAACAAGTCATTTTAAATAAGG + Intergenic
1044840933 8:96336495-96336517 GAAGCTAGCCCTTTAAAATACGG + Exonic
1045380095 8:101615334-101615356 GCAGGAAGCAATATTAAATGTGG - Intronic
1045620569 8:103972786-103972808 GCATTTTGCAATTTTATATAGGG - Intronic
1046112090 8:109737680-109737702 GCAGATTACAATTTTAAATAGGG + Intergenic
1046475022 8:114730865-114730887 GCACATTGCAATTTTCAATAAGG - Intergenic
1047457536 8:125029597-125029619 GCATCTAGCAATTTTTCATATGG + Intronic
1048047433 8:130786060-130786082 GCTGCGTTCAATTTTAAATAAGG - Intronic
1048412169 8:134186311-134186333 GAAGTTAGCAATTTAAAAGATGG + Intergenic
1048773019 8:137915654-137915676 GCAACTAGCCCTTTTAGATAAGG + Intergenic
1049027999 8:140010438-140010460 GCAGATAGCAAATTCAGATAAGG + Intronic
1050364228 9:4859271-4859293 GCAGAAGGCAATATTAAATAAGG - Intronic
1051356940 9:16247999-16248021 GCAGCTGGAAAATCTAAATATGG + Intronic
1051688253 9:19681335-19681357 AGAGGTTGCAATTTTAAATAAGG - Intronic
1053341711 9:37341684-37341706 GGAGCTAGCCATTTTAAATAGGG + Intronic
1057026197 9:91735531-91735553 GCAGCTAGCATTTTAAAAGATGG + Intronic
1057396896 9:94688744-94688766 GTGGCTTGCAATTTTAAATTAGG + Intergenic
1058067693 9:100567343-100567365 GAGGGTTGCAATTTTAAATAAGG - Intronic
1058672685 9:107373826-107373848 GCAGCCTGTAATTTTAAATGAGG + Intergenic
1186011507 X:5139173-5139195 ACAGCAAACAATTTAAAATAGGG + Intergenic
1188665209 X:32811030-32811052 CCAGCATGCAATTTTAGATAGGG - Intronic
1188962136 X:36505376-36505398 GCAGTTGGCAATTCTATATATGG - Intergenic
1190640575 X:52480469-52480491 GCAGCTTGCAATTTGAAATGAGG + Intergenic
1190647097 X:52532396-52532418 GCAGCTTGCAATTTGAAATGAGG - Intergenic
1191976999 X:66884041-66884063 GCAGTTTGCAATATTAAATAGGG - Intergenic
1193135981 X:77970957-77970979 GTAGGTTGCAGTTTTAAATAGGG + Intronic
1193812727 X:86070490-86070512 GCACCTAGCAATTTAAAAAAAGG - Intergenic
1194407415 X:93513926-93513948 AGAGCTCTCAATTTTAAATAAGG + Intergenic
1195483959 X:105381219-105381241 ACAGCTAGGAATATTAAATTTGG + Intronic
1195791641 X:108594749-108594771 GGGGGTTGCAATTTTAAATAGGG - Intronic
1196681677 X:118475942-118475964 GTGGGTTGCAATTTTAAATAAGG + Intergenic
1198379173 X:136068178-136068200 TCGGCTTGCAATTTTAAAAAAGG + Intergenic
1198743639 X:139867362-139867384 GGAGGTTGCAATTTTAGATAGGG + Intronic
1198999738 X:142620678-142620700 GCAGGTTGCAATTTTAACTAAGG - Intergenic