ID: 974433644

View in Genome Browser
Species Human (GRCh38)
Location 4:61830480-61830502
Sequence AATGATCTTGAATATAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974433644 Original CRISPR AATGATCTTGAATATAGACA TGG (reversed) Intronic
901381095 1:8874888-8874910 ATGGATCTTGAGAATAGACATGG + Exonic
904861942 1:33544985-33545007 AATGAGCTTGAACAAAAACATGG + Intronic
904983540 1:34526218-34526240 AATGGTCTTCAATCTGGACAGGG - Intergenic
907113934 1:51952008-51952030 AATGGTGATGAATTTAGACAGGG - Intronic
907167439 1:52426416-52426438 AATGATCCAGAATATAAACTGGG - Intronic
908622251 1:65997107-65997129 AATGGTCTTGAATATATCCTGGG + Intronic
912884350 1:113453997-113454019 AATAATGTTTAATATAGAAAAGG - Intronic
916327825 1:163582706-163582728 GATCATCTTTCATATAGACATGG + Intergenic
917404484 1:174689774-174689796 ACTGATCTTGACTAAAGACCTGG - Intronic
918692816 1:187503101-187503123 AAGGATATTAAATATGGACATGG - Intergenic
919248340 1:195018046-195018068 AATGATTTTGAACATAGTTACGG + Intergenic
919953084 1:202384195-202384217 AATTATTTTGAATATATACCTGG - Intronic
920738707 1:208559685-208559707 AATTTTCTTGAAAATAGTCATGG - Intergenic
921623066 1:217347695-217347717 AAAGATCCTTAATATAGAAATGG - Intergenic
923722990 1:236483163-236483185 ATGGATCTTGAGAATAGACATGG - Intronic
924300085 1:242628248-242628270 ACAGATATTGAATATAGACAAGG + Intergenic
924312322 1:242756976-242756998 AAAAATCTTGAATATATACGTGG + Intergenic
1062808882 10:447319-447341 TGTGATCCTGAATATCGACAGGG - Intronic
1062808938 10:447617-447639 TGTGATCCTGAGTATAGACAGGG - Intronic
1062808992 10:447917-447939 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809056 10:448267-448289 TGTGATCCTGAGTATAGACAGGG - Intronic
1062809084 10:448416-448438 AGTGATCCTGATTATCGACAGGG - Intronic
1062809131 10:448668-448690 TGTGATCCTGAATATCGACAGGG - Intronic
1064051145 10:12060593-12060615 AATGATCTTGAACATGGATGAGG - Intergenic
1067169453 10:43894542-43894564 AATGATCTAGATTACAGAAATGG + Intergenic
1069390439 10:67929382-67929404 AATTATAGTGAATAGAGACAAGG - Intronic
1070069604 10:73074443-73074465 TATTATTTTGAATAGAGACAGGG - Intronic
1072003837 10:91222672-91222694 AATGATTTTGGAAACAGACATGG + Exonic
1073364933 10:102931673-102931695 AATTCTCTTGGATATATACACGG + Intronic
1073837633 10:107463174-107463196 AAAAATCTTGAATGTAGCCAGGG + Intergenic
1074129647 10:110562658-110562680 AATGATACTGAATATACCCAAGG - Intergenic
1074147415 10:110729143-110729165 AAGTATCTTGAATACAGAGAAGG + Intronic
1078911814 11:15739663-15739685 AATAATTATTAATATAGACAGGG + Intergenic
1079607014 11:22382538-22382560 AATGATGCTGAATATGGGCAGGG - Intergenic
1079721786 11:23825047-23825069 AAAGTTCTTGAATATAGCCAAGG + Intergenic
1080294608 11:30712581-30712603 AATGCTTTTGAATATTGAGAGGG + Intergenic
1080552093 11:33381520-33381542 AATGATGTTGAAGAGAGAGATGG + Intergenic
1081056954 11:38421527-38421549 AATGCTCTTCAATTTAAACATGG + Intergenic
1081388249 11:42498881-42498903 AATGATCTGGAAAATGGAAAGGG - Intergenic
1082064642 11:47890033-47890055 AATGATCTTTAGTCTAGAGAAGG + Intergenic
1082669529 11:56017367-56017389 AATGATTTTAAATATAGAATCGG + Intergenic
1082785833 11:57316023-57316045 ATTAATAGTGAATATAGACAGGG - Intronic
1083063236 11:59896755-59896777 ATTGATCTTGAAGAAAGATACGG - Intergenic
1086522118 11:87681027-87681049 AATGTTTTTGAATATATAGATGG - Intergenic
1086800939 11:91174303-91174325 AATCAACTTGTATATACACAAGG + Intergenic
1090639924 11:128721567-128721589 ATTGATCTTGTATAAAGAGATGG - Intronic
1091805549 12:3353542-3353564 AATGAGCTTAAATATAGGGAAGG + Intergenic
1092098089 12:5860917-5860939 AATACTCTGGAAAATAGACAAGG + Intronic
1092158288 12:6299476-6299498 GATGATCTTTAAGATAGATAAGG - Intergenic
1092588233 12:9922382-9922404 AATGATCTTCCTTACAGACAGGG - Intronic
1092990892 12:13898111-13898133 AATGACAGTGAATATAGACAGGG + Intronic
1093838156 12:23861899-23861921 ACAGACCTTGAACATAGACAGGG + Intronic
1095150860 12:38795369-38795391 AATTATTTTGAATATACACATGG - Intronic
1095425876 12:42074275-42074297 AATGTTCTTGAATAAACAGATGG + Intergenic
1095469428 12:42520685-42520707 AATGTTCTTTAATTTAGGCAGGG + Intronic
1096063477 12:48721328-48721350 AATGATCTTGGCTATTGATATGG - Intergenic
1097243560 12:57592375-57592397 AGCGTTCTTGAATATAGTCATGG + Intronic
1097409449 12:59233148-59233170 AATGATCTTCAAAATATAAAGGG - Intergenic
1098712560 12:73782846-73782868 AATTATTTTTAATAGAGACAGGG - Intergenic
1099703047 12:86113673-86113695 AAGTTTCTTGAATACAGACAAGG - Intronic
1100130765 12:91490368-91490390 AATGATCTTGAGACAAGACATGG - Intergenic
1100144548 12:91661782-91661804 AATTATCCTAAATGTAGACATGG + Intergenic
1104424807 12:128667363-128667385 AATGAACCTGAAAATAGACCTGG + Intronic
1105659238 13:22475054-22475076 TATGATATTGAATTTAGCCAAGG + Intergenic
1107270078 13:38605748-38605770 AAAAATCCTGAATAAAGACAGGG + Intergenic
1107998221 13:45882652-45882674 AATGATGTTGATTTTAGAAAGGG - Intergenic
1108761270 13:53568506-53568528 AATGCTCTTGTATAAAGAGAGGG - Intergenic
1109486586 13:63029865-63029887 AATGATCTTGTATCTAGGCATGG + Intergenic
1109535355 13:63710564-63710586 AATGAGCTTGAGTATTGCCATGG + Intergenic
1110969366 13:81741449-81741471 AAAAGTCTTGAATATACACAGGG + Intergenic
1111307340 13:86432797-86432819 AATAATTTTAAATTTAGACATGG - Intergenic
1111939399 13:94593840-94593862 TATGATCATAAATCTAGACAAGG - Exonic
1116054558 14:39847390-39847412 AATAATATTGAACATAGTCATGG - Intergenic
1116748784 14:48854824-48854846 AGTGTTCTAGAATATAGAAAAGG - Intergenic
1116936372 14:50744764-50744786 AATTATTTTTAATAGAGACAGGG - Intronic
1117643336 14:57823826-57823848 AAAAATTTTAAATATAGACATGG + Intronic
1120032207 14:79654750-79654772 AATGGTATAGAATTTAGACAGGG + Intronic
1121530904 14:94652737-94652759 AAAGAACTTGAATAGAGACCAGG + Intergenic
1121559031 14:94860787-94860809 AATGATCTAGGAGAAAGACAGGG - Intergenic
1122735304 14:103835911-103835933 AATTTTTTTTAATATAGACAGGG + Intronic
1124066079 15:26345287-26345309 GATTATCCTGATTATAGACATGG - Intergenic
1124881270 15:33645051-33645073 TATAATCTTGAATATAGGTATGG - Intronic
1125294699 15:38190184-38190206 AATGTTCTTGAATATTTAAAAGG - Intergenic
1133640509 16:7712538-7712560 AGTGATCTTGAAAAGAGAAAAGG + Intronic
1135262226 16:20990445-20990467 AATGATTTTTAATATATTCAGGG + Intronic
1138674328 16:58640147-58640169 ATTGATCTTGCATTTAAACAAGG + Intergenic
1140186756 16:72780380-72780402 AATGATCTGTAAGGTAGACAAGG - Intergenic
1145356309 17:22157616-22157638 AATGATCTTGTATCTGGGCATGG - Intergenic
1148495962 17:48053815-48053837 AATGCTCTTGAATAAAGCCGGGG + Intronic
1149404530 17:56334231-56334253 CATTTTCTTGAATATACACATGG - Intronic
1149887226 17:60352111-60352133 TATCATCTTGAATAAAGTCAGGG - Intronic
1155325619 18:24661805-24661827 AATTATCTTATATATAGAAAAGG - Intergenic
1155972969 18:32098944-32098966 AATGATCTCGATTATCGACTCGG + Intronic
1157022858 18:43807477-43807499 GATGATCTTGAAGAAAGCCAGGG + Intergenic
1158014642 18:52769654-52769676 AATGATCTTGGGTATAGAGATGG - Intronic
1159104377 18:63988948-63988970 CATTATCTTGAATATAGCGATGG - Exonic
1160164955 18:76502588-76502610 AATTATCTTTAAAATAGCCAGGG - Intergenic
1161520732 19:4722414-4722436 CCTGCTCTAGAATATAGACATGG - Intronic
1162605838 19:11707158-11707180 AATTCTCTTGAATATATACATGG - Intergenic
1162637680 19:11983147-11983169 AGTGATTTGGAATATGGACAGGG + Intergenic
1163521460 19:17794543-17794565 AATTATTTTCAATATAGAGATGG + Intergenic
1165539681 19:36482054-36482076 AATGAAGTTGAATATATACAAGG + Intronic
925539274 2:4949352-4949374 AATGCTCCTTAATATAAACATGG - Intergenic
929290817 2:40189178-40189200 TATGATGTTTCATATAGACAAGG - Intronic
931566092 2:63617266-63617288 AATTATCTTGAACTTAGAGATGG + Intronic
932539070 2:72632461-72632483 AATTATCTTAAATATGGAAATGG + Intronic
933000455 2:76915833-76915855 AATGATATTGAATATTGATAAGG - Intronic
934478395 2:94609826-94609848 AATAATCTGCAAGATAGACATGG - Intergenic
935307627 2:101752798-101752820 AATGATGTGGAATGTGGACACGG - Intronic
935782466 2:106520138-106520160 AATGAACTATAATTTAGACAAGG - Intergenic
936170806 2:110171507-110171529 AATGATCTAAAACATAAACAGGG + Intronic
937928963 2:127190055-127190077 AATTATCCTGAACCTAGACAGGG - Intronic
938219763 2:129555793-129555815 CATGATCTTGAATTTAGCAAAGG - Intergenic
940139606 2:150479171-150479193 AATGATCTTGAATACAAAGATGG - Intronic
941728777 2:168892439-168892461 AATGATCGTGAATAATGCCATGG + Intronic
942433671 2:175945593-175945615 AATAAACTTGAATCCAGACATGG + Intronic
943591034 2:189797020-189797042 AATGTGCTTGAATATAGTAAAGG - Intronic
944059779 2:195560288-195560310 AATGATCTTGAATTGAGATTTGG + Intergenic
944948659 2:204720911-204720933 ATTAATCTAGTATATAGACAGGG - Intronic
946605076 2:221395092-221395114 AATTATGATGAATATATACATGG + Intergenic
946625404 2:221606909-221606931 AAAAATCTTGTTTATAGACATGG - Intergenic
946640312 2:221776719-221776741 AATAATTTTTAATAAAGACAAGG + Intergenic
948896020 2:240927470-240927492 AATTATCTAGAATATAGTCTAGG - Intronic
1169843162 20:9961762-9961784 AATCATCATGAATCTGGACAGGG + Intergenic
1171515765 20:25732988-25733010 AGTGTCCTTGAATATAGAGATGG + Intergenic
1172300121 20:33843857-33843879 AGTTACCTTGAAAATAGACATGG - Intronic
1173096821 20:40041273-40041295 AATTTTCTAGAATATAGACTTGG + Intergenic
1174748494 20:53088033-53088055 ATTCATCTTGAAGACAGACATGG - Intronic
1175364678 20:58444464-58444486 AATGATCTTTATTAATGACAAGG + Exonic
1177285631 21:19045062-19045084 AATGATGTTAAATAAAGTCATGG - Intergenic
1177286553 21:19058850-19058872 AATGATCTTAAAGATAGCTAAGG - Intergenic
1177893690 21:26836885-26836907 AATGCACTTGAATAAATACATGG + Exonic
1182854029 22:33501484-33501506 AATTAACTTGAATATAGAGTGGG + Intronic
949124681 3:433019-433041 AGAGATGTTTAATATAGACATGG + Intergenic
949407903 3:3733974-3733996 AATGATCTAAAAAATAGATATGG - Intronic
949673706 3:6428286-6428308 AATACTCTAGAATATAGAGATGG - Intergenic
950733819 3:14988436-14988458 AATTATCCTAAATATAGAAATGG - Intronic
951008782 3:17651493-17651515 ACTGGTCTTGAATATGGACAAGG - Intronic
951503068 3:23412322-23412344 AATGATCTAGTATACAAACAAGG - Intronic
952360263 3:32624245-32624267 AATAATTTTTAATAGAGACAGGG + Intergenic
957442639 3:80270166-80270188 AATAGTCTAGAATATAGATATGG + Intergenic
957708456 3:83821507-83821529 AAGAATACTGAATATAGACAAGG - Intergenic
957736781 3:84213856-84213878 AATAACCTTGAATGTAAACAGGG + Intergenic
957778559 3:84788283-84788305 GATGATCTAAAATATACACAAGG - Intergenic
959470746 3:106747067-106747089 AATGTTCTGGCTTATAGACAAGG + Intergenic
959985465 3:112566407-112566429 AATGTTCTAGAATATAGATTTGG + Intronic
960893301 3:122474538-122474560 AATGATCTTCAACAAAGAAAAGG + Intronic
963071749 3:141310624-141310646 AATGGGCTTGAATTCAGACAAGG - Intergenic
963550332 3:146713541-146713563 AATAATGAAGAATATAGACATGG + Intergenic
964145496 3:153457059-153457081 AATCATCTTGAATATAACTAAGG - Intergenic
964774533 3:160261478-160261500 AAAGATTTTGAAAATAGAGAAGG + Intronic
965026297 3:163304890-163304912 AATGATCTTGAATAAGGTCTGGG - Intergenic
968712863 4:2132578-2132600 AATCATCTTGAAACTAGCCAGGG + Intronic
970726966 4:19058773-19058795 TAGGATATTGAATATATACAAGG - Intergenic
971223193 4:24727801-24727823 AATGATTTTAAATAAAGGCATGG - Intergenic
971511146 4:27425624-27425646 AATACTCTGGAATATAGTCAGGG + Intergenic
971786883 4:31116040-31116062 AATTAACCTGCATATAGACAGGG - Intronic
972462403 4:39316840-39316862 AATCATCGTGAATACATACATGG + Intronic
972959579 4:44436199-44436221 AAAGAAGTTGAATATAGTCATGG + Intronic
974433644 4:61830480-61830502 AATGATCTTGAATATAGACATGG - Intronic
975299438 4:72772557-72772579 AATAATGTTGAAAATAGCCAAGG - Intergenic
976568599 4:86582479-86582501 TATGATCATGAATAAAGATAAGG - Intronic
976919199 4:90416179-90416201 AATAAGATTGAATATAGTCAAGG - Intronic
977232762 4:94471168-94471190 GCTGATCTTGAATATTGATATGG - Intronic
977801837 4:101243601-101243623 AATGATTTCAAATATATACAAGG + Intronic
978069210 4:104445861-104445883 AAAGATCTTGAACAAAGACTTGG - Intergenic
979539175 4:121860627-121860649 AATACACTTGTATATAGACATGG - Intronic
979762017 4:124418000-124418022 AATAAGCTTGAGTGTAGACAAGG - Intergenic
980065499 4:128183558-128183580 AATGCTGATGAATATATACAAGG + Intronic
980386721 4:132094554-132094576 AATTAACTTGAATATATGCATGG + Intergenic
980758384 4:137195710-137195732 AATGATCTTGAATAATGAATAGG + Intergenic
982143185 4:152350632-152350654 AATAATCTTGAATAGTGATAAGG + Intronic
982615119 4:157632099-157632121 AATGAACTGGAATATAGATCAGG + Intergenic
983336832 4:166405430-166405452 AATAATAATTAATATAGACAGGG - Intergenic
984154889 4:176184107-176184129 AATAATCTTTTATATATACATGG - Intergenic
985072174 4:186177251-186177273 AATGATGTTAAAAATAAACATGG + Intergenic
986303459 5:6497271-6497293 AATGATCTTGAATATTGACTAGG - Intergenic
987023256 5:13896816-13896838 AATGATTATTAATATTGACATGG - Intronic
987226453 5:15846976-15846998 AATAATCTTGAATATTGATGAGG + Intronic
993096220 5:83481869-83481891 ACTGATCTTGAACATAAATAGGG - Intronic
994103017 5:95914880-95914902 AATAATCATGAATATTAACATGG + Intronic
994209776 5:97074377-97074399 GAGTATCTTGAATTTAGACAAGG + Intergenic
994569437 5:101496359-101496381 GATGAACTTGAGTATAGTCATGG + Intergenic
996431764 5:123388266-123388288 AATGATTTTGAATTCAAACAAGG - Intronic
998363567 5:141612703-141612725 CATTATCTTGACTATAGAAATGG + Intronic
999645169 5:153710642-153710664 AATGATCTTGACCACACACATGG - Intronic
1001624456 5:173118865-173118887 AATAATTTTAAATAGAGACAAGG - Intronic
1004942055 6:20568948-20568970 ACTGATCTTGAGTACAGAGATGG + Intronic
1006017279 6:31091976-31091998 AATTTTCTTTAATAGAGACAGGG - Intergenic
1006699796 6:35962751-35962773 AATGAGTTGGAACATAGACATGG - Intronic
1007012108 6:38427669-38427691 AATTATCTTGATTGTTGACAGGG - Intronic
1007124745 6:39416415-39416437 AATGATCTTGTATATGGAACAGG + Intronic
1011945279 6:92892570-92892592 AATGATGTTGAATATGGACATGG + Intergenic
1012601247 6:101099874-101099896 CATGAGGTTGCATATAGACACGG - Intergenic
1013048124 6:106507851-106507873 TATGATCTTGGATATCCACAGGG + Intergenic
1013052778 6:106553291-106553313 ATTGATCATGAATGTAGACATGG + Intronic
1014006266 6:116422387-116422409 AATATTCTTGAAAATAAACAAGG - Intronic
1015443748 6:133278896-133278918 AATGTTCTTGATAATAGAAATGG + Intronic
1015647052 6:135403814-135403836 CAGGATATGGAATATAGACAAGG - Intronic
1015795838 6:137010187-137010209 AATGATCTAGAACAGAGACCAGG + Intronic
1016076151 6:139797904-139797926 AAAGATCTTGAATACAGTCGTGG - Intergenic
1016476655 6:144434533-144434555 AAAGGTTTTGAATATGGACATGG + Intronic
1017355824 6:153506504-153506526 AATGACTTTGAATAAACACAAGG + Intergenic
1017613600 6:156218284-156218306 AATAGTGTGGAATATAGACAGGG + Intergenic
1020706471 7:11550363-11550385 TATGCTCTTGAATAGTGACATGG + Intronic
1020757175 7:12217136-12217158 AATGTTCTTGAATAGACAGAAGG + Intronic
1021334324 7:19379968-19379990 TATGAACTCGAATATAGACATGG - Intergenic
1022155018 7:27651981-27652003 AAGGAACATGAATATATACAAGG + Intronic
1023330767 7:39114103-39114125 AAACATCCTGAATATTGACATGG + Intronic
1023741426 7:43284570-43284592 ATTGATCTTGAAAATTGACAAGG - Intronic
1026471602 7:70697838-70697860 AATGTTCTGGAAAATAAACATGG - Intronic
1029911247 7:104151161-104151183 AATGCTATTGAATGTAGACTTGG + Intronic
1030546133 7:110897926-110897948 AATTATATTGAAGATACACAAGG + Intronic
1031045089 7:116878823-116878845 AATATTCTTAAATATAGACCTGG - Intronic
1031106645 7:117551869-117551891 AATGATCAATAATAGAGACAAGG - Intronic
1031626055 7:123994463-123994485 AACCATCTTGAATGTAGAAAAGG - Intergenic
1032954474 7:136954734-136954756 AATGATCTTGACTACATCCATGG + Intronic
1035065630 7:156103112-156103134 AATGATCCAGAATATAGAGGAGG - Intergenic
1035936872 8:3851230-3851252 AATGAATTTGCATCTAGACAAGG + Intronic
1036958048 8:13212269-13212291 GAAGATCAGGAATATAGACAGGG - Intronic
1037147747 8:15593743-15593765 AAGGATCTTGGATGTAGAAAGGG - Intronic
1041207221 8:55511241-55511263 AAGGATCTTGAATATAGAATTGG - Intronic
1043841370 8:85107869-85107891 AATGATTTCGAATGCAGACAAGG - Intronic
1047749703 8:127871043-127871065 GGTGATCTGGAATATAGACCAGG - Intergenic
1051773243 9:20603005-20603027 AATGATCTTTCATATATAGAGGG - Intronic
1051908552 9:22126251-22126273 ATTCATCATGAATATGGACATGG - Intergenic
1051942631 9:22527050-22527072 AAGGATCTTGAGTTAAGACATGG + Intergenic
1052248427 9:26367305-26367327 AATTATGTTGAACATACACATGG - Intergenic
1052949431 9:34196615-34196637 AATTTTTTTTAATATAGACACGG + Intronic
1053144161 9:35700728-35700750 AATGTTCTGGAATATAGGAATGG + Intronic
1053577449 9:39367057-39367079 AATTATGATGAATATAGAAAGGG - Intergenic
1053841955 9:42195011-42195033 AATTATGATGAATATAGAAAGGG - Intergenic
1054099024 9:60925776-60925798 AATTATGATGAATATAGAAAGGG - Intergenic
1054120422 9:61201398-61201420 AATTATGATGAATATAGAAAGGG - Intergenic
1054587329 9:66981158-66981180 AATTATGATGAATATAGAAAGGG + Intergenic
1055723147 9:79198072-79198094 AATAATCTTTAATACAGACCTGG + Intergenic
1055780243 9:79813261-79813283 AAAGATCTTGAATATTTACCAGG - Intergenic
1056291519 9:85148489-85148511 AATGATCTAGAATATATAAATGG - Intergenic
1059577197 9:115503101-115503123 AATGATCATAAATGTAGACTTGG + Intergenic
1061682862 9:132251647-132251669 CATGATTTTAAAGATAGACAAGG - Intergenic
1187688987 X:21844752-21844774 AATGAGCTTAAATATTAACATGG - Intronic
1187949551 X:24458228-24458250 AAAAATCTAGAATCTAGACACGG + Intergenic
1190395033 X:49973610-49973632 AATGATCTTAAGTATACAGATGG + Intronic
1190481949 X:50886026-50886048 GATGATCTTGAACATAGCTAAGG + Intergenic
1190524266 X:51312147-51312169 AATTGTCTTGAATATAGGGATGG + Intergenic
1195530428 X:105948298-105948320 AATATTTTTGAATATACACAAGG - Intronic
1196701540 X:118674663-118674685 AATTCTCTTGAATATATACTAGG + Intronic
1196752325 X:119129093-119129115 AATGATGATCAAAATAGACAAGG - Intronic
1197158197 X:123293113-123293135 AAGGAACTTCAAGATAGACACGG + Intronic
1198009344 X:132535011-132535033 AATCAATTTGAATATAGACAAGG - Intergenic