ID: 974435655

View in Genome Browser
Species Human (GRCh38)
Location 4:61854256-61854278
Sequence TCCTACTAGAAAACAACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 291}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974435655_974435658 13 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435658 4:61854292-61854314 ACACCAGCCTCCTTGGAGGAAGG No data
974435655_974435664 26 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435664 4:61854305-61854327 TGGAGGAAGGGCTGATTCTAGGG 0: 1
1: 1
2: 25
3: 167
4: 495
974435655_974435663 25 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435663 4:61854304-61854326 TTGGAGGAAGGGCTGATTCTAGG 0: 1
1: 1
2: 76
3: 329
4: 842
974435655_974435659 14 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435659 4:61854293-61854315 CACCAGCCTCCTTGGAGGAAGGG 0: 1
1: 0
2: 2
3: 20
4: 290
974435655_974435657 9 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435657 4:61854288-61854310 AAAAACACCAGCCTCCTTGGAGG No data
974435655_974435656 6 Left 974435655 4:61854256-61854278 CCATGTGTTGTTTTCTAGTAGGA 0: 1
1: 0
2: 4
3: 31
4: 291
Right 974435656 4:61854285-61854307 AATAAAAACACCAGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974435655 Original CRISPR TCCTACTAGAAAACAACACA TGG (reversed) Intronic
902417933 1:16253013-16253035 TACTCCTAGAAAAGAAGACAGGG + Intronic
902444200 1:16451766-16451788 TGCTACCAGAAAACCCCACAAGG - Intronic
904121862 1:28203809-28203831 TCCTCCTAGGAAACGACAAAGGG - Exonic
905178319 1:36151765-36151787 TCTCCCTAGAAAACAACACAAGG + Intronic
907795887 1:57716625-57716647 AACTACTAGAAGAAAACACAGGG + Intronic
908175702 1:61553100-61553122 TCATAGCAGAAAACAACACAAGG - Intergenic
911087140 1:93988568-93988590 TCCTACTATAAAACAGAAAATGG + Intergenic
911736427 1:101341684-101341706 TCCTACTAAAAAAAAAAAAAAGG - Intergenic
912980802 1:114369780-114369802 TCCTAGAAGAAAAAAAGACAAGG - Intergenic
915063710 1:153207563-153207585 TCCTTTTAGAAAACAATTCAAGG + Intergenic
915822745 1:159042760-159042782 TCCTAGGGGAAGACAACACAGGG + Intronic
916007935 1:160678857-160678879 GTGTACTAGAAAACAACAAAGGG + Exonic
916102595 1:161406049-161406071 TTCTGCGAGAAAACAACAAATGG + Intergenic
917826576 1:178828006-178828028 AACTACTAGAAGAAAACACACGG + Intronic
918164533 1:181931864-181931886 CCTTACCAAAAAACAACACAGGG + Intergenic
918652406 1:186982091-186982113 AGCTTCTAGAATACAACACAGGG + Intronic
918760627 1:188400788-188400810 CACTACTAGACAAAAACACAGGG + Intergenic
923038559 1:230302564-230302586 TCCTCCTACAAATCAACTCAGGG + Intergenic
1063901732 10:10740220-10740242 AACTACTAGAAGAAAACACAGGG - Intergenic
1064428222 10:15248802-15248824 TCCTTCTAGGAAACAGCACCAGG - Exonic
1064823582 10:19368221-19368243 GCCTACTAGAAGAAAACATAAGG - Intronic
1071243093 10:83730985-83731007 AACTACTAGAAGAAAACACAGGG - Intergenic
1071678313 10:87678337-87678359 AACTACTAGAAGAAAACACAGGG + Intronic
1071711119 10:88050514-88050536 TTCTTCTAGAAAATAACACATGG + Intergenic
1072187643 10:93056704-93056726 TTTTACTAGAAAACAACCCCTGG + Intronic
1072515391 10:96176595-96176617 TTCTACAAAAAAACAAAACAAGG + Intronic
1073459517 10:103658606-103658628 TCCTAGTAGATAGCAACAGACGG + Intronic
1073622831 10:105066712-105066734 GCCAATTAGAAAACAACACCAGG - Intronic
1074201292 10:111237692-111237714 AACCTCTAGAAAACAACACAAGG - Intergenic
1075192268 10:120320478-120320500 TCTTTCTAAAACACAACACAAGG + Intergenic
1075816532 10:125269011-125269033 AACTACTAGAAGAAAACACAGGG - Intergenic
1079288003 11:19157175-19157197 TGCTACAAGAAAATAAAACAGGG - Intronic
1081828750 11:46086616-46086638 TTCTTCTTGAAAACAACACTTGG + Intronic
1082645648 11:55721131-55721153 TCCTACAATTCAACAACACAAGG - Intergenic
1082898129 11:58214720-58214742 TCCTACAAGAAAACCTAACATGG - Intergenic
1085572241 11:77569479-77569501 TCACAGCAGAAAACAACACAAGG - Intronic
1085612654 11:77966397-77966419 AACTACTAGAAGAAAACACAGGG - Intronic
1086397069 11:86426676-86426698 AACTACTAGAAGAAAACACAGGG - Intergenic
1087620298 11:100533345-100533367 TATTACTAGAAGAAAACACAGGG + Intergenic
1088243610 11:107795361-107795383 AGCTACTAGAAGAAAACACAGGG + Intronic
1088449771 11:109968733-109968755 TCCTACTAGAAGACACCAGCAGG + Intergenic
1090720082 11:129464067-129464089 TACTACTAGAAGAAAGCACAGGG + Intergenic
1093546540 12:20355324-20355346 TCTTACTTGCAAATAACACATGG - Intergenic
1094165985 12:27444388-27444410 AACTACTAGAAGAAAACACAGGG + Intergenic
1094457526 12:30654245-30654267 AACTACTAGAAAAAAACACAGGG + Intronic
1095238229 12:39824670-39824692 TCCTACTGGAACACCTCACAGGG - Intronic
1095570636 12:43681399-43681421 TCTTGCTAGAAAAAAACAAAAGG + Intergenic
1096591887 12:52665514-52665536 TCCCGCAACAAAACAACACATGG - Intergenic
1096881594 12:54677388-54677410 GGCTCCTAGAAGACAACACAGGG + Intergenic
1097407401 12:59207140-59207162 AACTACTAGAAGAAAACACAGGG + Intergenic
1097947152 12:65382408-65382430 TATTACTATATAACAACACAGGG - Intronic
1098724586 12:73946879-73946901 TCCTGCTAGAAAAATACAGATGG + Intergenic
1099056501 12:77848231-77848253 TTCCACTAGAAAACAACACTTGG + Intronic
1100909289 12:99339276-99339298 TCATAGTGGAAAGCAACACAGGG - Intronic
1104491511 12:129197681-129197703 AACTACTAGAAGAAAACACAGGG + Intronic
1104752910 12:131251358-131251380 TCCTAATATAAACTAACACAGGG - Intergenic
1105602259 13:21897838-21897860 TCCTACTAGAAAGAACCACTAGG - Intergenic
1105698961 13:22920418-22920440 AACTACTAGAAGAAAACACAGGG + Intergenic
1106821433 13:33468746-33468768 TGCTTCTAGAAAAGAATACATGG - Intergenic
1107179302 13:37439950-37439972 AACTACTAGAAGAAAACACAAGG - Intergenic
1107651081 13:42545855-42545877 TCCTATTATAAAACAAAAGAAGG - Intergenic
1107793057 13:44021913-44021935 TCTTACGAGCAAACAACAAAAGG + Intergenic
1107895775 13:44961159-44961181 TCATAGTAGACAATAACACAAGG + Intronic
1107976473 13:45693294-45693316 TCATGCTAGAAAACCACAGAGGG + Intergenic
1108657975 13:52554283-52554305 AACTACTAGAAGAAAACACAGGG - Intergenic
1109781419 13:67115175-67115197 TCCTATTCCAAAACAACATATGG - Intronic
1110229095 13:73149848-73149870 TCACACCAGAAAAAAACACAGGG - Intergenic
1110900405 13:80815519-80815541 TCCTATTATAAATCAACACAGGG - Intergenic
1111378672 13:87415780-87415802 TTCAGCTAGAAAATAACACAAGG - Intergenic
1112633742 13:101191423-101191445 TGCGACTGGAAAAAAACACATGG - Intronic
1114382971 14:22227713-22227735 ACCTACTAGCAAAGAACAAAGGG + Intergenic
1115826227 14:37281108-37281130 AACTACTAGAAGATAACACAGGG - Intronic
1116604380 14:46970587-46970609 GCCAACTAGAAAACAACATAGGG + Intronic
1117881054 14:60314082-60314104 CCCATCTAGAAAACAAAACAGGG + Intergenic
1117935351 14:60898855-60898877 AACTACTAGAAAAAAACAAAGGG - Intronic
1118962109 14:70543406-70543428 TACTAATAGAAAATAACACATGG + Intergenic
1120236459 14:81897070-81897092 ACCTACTATAAGAAAACACAGGG - Intergenic
1122840149 14:104456603-104456625 AACTACTAGAAGAAAACACAGGG + Intergenic
1126204598 15:46030955-46030977 AACTACAAGAAAACAACATAAGG - Intergenic
1126258920 15:46663779-46663801 AACTACTAGAAAAAAATACAGGG + Intergenic
1126497720 15:49310989-49311011 AACTACTAGAAGAGAACACAGGG - Intronic
1127529070 15:59825091-59825113 TTATTTTAGAAAACAACACAGGG + Intergenic
1128008325 15:64266904-64266926 AACTACTAGAATAAAACACAAGG + Intronic
1128876300 15:71204182-71204204 TATAACTAGAAAATAACACAGGG - Intronic
1129139161 15:73581527-73581549 TCCTAATAAATAGCAACACAGGG + Intronic
1131504268 15:93002159-93002181 TCATCCTAGGAAACAAAACAGGG - Exonic
1133848538 16:9479937-9479959 TCCTTTTAGAAAATATCACATGG - Intergenic
1134182688 16:12060595-12060617 TCCAACTCTAAAACAAAACAAGG + Intronic
1134283644 16:12840581-12840603 AACTACTAGAAGAAAACACAGGG + Intergenic
1134492304 16:14704155-14704177 TCAATCTAGAAAACAAAACAAGG + Intergenic
1134497685 16:14743277-14743299 TCAATCTAGAAAACAAAACAAGG + Intronic
1135090642 16:19512655-19512677 AACTACTAGAAGAAAACACAGGG - Intronic
1135806141 16:25544667-25544689 TCCCACTAGGACACATCACATGG - Intergenic
1136152918 16:28364079-28364101 TCAATCTAGAAAACAAAACAAGG - Intergenic
1136210165 16:28751194-28751216 TCAATCTAGAAAACAAAACAAGG + Intergenic
1136900789 16:34035204-34035226 TAGTACCAGAAAAGAACACATGG - Intergenic
1136968033 16:34938397-34938419 TAGTACCAGAAAACAACACATGG - Intergenic
1137478561 16:48831763-48831785 TGCTACTGGAGAACAACAAAGGG - Intergenic
1139619935 16:68130741-68130763 AACTACTAGAAGAAAACACAGGG - Intronic
1142721324 17:1777821-1777843 GCCTGCTCGTAAACAACACATGG + Intergenic
1142946185 17:3430324-3430346 AACTACTAGAAGACAACATAGGG + Intergenic
1144259916 17:13508273-13508295 TACTTCAAGAAAACAGCACAGGG + Intronic
1146242673 17:31244564-31244586 TCATAGCAGAAAGCAACACAGGG - Intronic
1147807995 17:43145961-43145983 TTCTACTACAAAACAACATGGGG - Intergenic
1150661252 17:67081704-67081726 TCCTTCTAGACATGAACACAAGG - Intronic
1151912476 17:77093000-77093022 TCCTACTCAAAGACATCACAAGG - Intronic
1152315731 17:79579322-79579344 TCCTACCAGAAAAGCCCACATGG + Intergenic
1153389204 18:4534937-4534959 TCCTGCTAGAGAAAAACAGAGGG - Intergenic
1153599887 18:6770054-6770076 TCCTTCTATAAAACAACAGATGG + Intronic
1155647011 18:28091195-28091217 TCCTACTAGAAATTGACACTGGG + Intronic
1156713848 18:39982405-39982427 TCATAGAAGAAAATAACACAAGG - Intergenic
1158109275 18:53922344-53922366 TCCTACTAAAAAAAAAAATAAGG + Intergenic
1158324313 18:56297701-56297723 TCCTACTAGAAAACACTACAGGG + Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1162667400 19:12225534-12225556 TACTAACAGAAAATAACACATGG - Intronic
1166417306 19:42605376-42605398 TCCAAGTAGAAATGAACACAGGG - Intronic
925984147 2:9201656-9201678 GAGTACTTGAAAACAACACATGG + Intergenic
927188038 2:20496607-20496629 TCCCACTAGAAGACAAAGCAGGG + Intergenic
929091300 2:38219901-38219923 AACTACTAGAAAAAAACATAGGG + Intergenic
930079563 2:47434573-47434595 TCCTACTGGAATAAAACAAAAGG - Intronic
930342999 2:50141351-50141373 AACTACTAGAAAAAAACATAGGG + Intronic
930499953 2:52201981-52202003 AACTACTAGAAAAAAACACAGGG + Intergenic
930552737 2:52855708-52855730 AACTACTAGAAGAAAACACAGGG + Intergenic
930638754 2:53834051-53834073 AACTACTAGAAAAAAACAAAGGG + Intergenic
932342465 2:70974964-70974986 TCCTCCTGGAAGACAGCACAGGG + Intronic
932717780 2:74114995-74115017 AACTACTAGAAGAAAACACAGGG + Intergenic
933158263 2:78997474-78997496 TCCTAGTTGAAAACAAATCATGG + Intergenic
933431815 2:82191064-82191086 TCATACAAGAAAACAATACTGGG - Intergenic
934928672 2:98401435-98401457 TCATACTAGAAGAAAACATAGGG - Intergenic
935996532 2:108780056-108780078 TCCTAATACTAAACTACACAAGG - Intronic
937739368 2:125332667-125332689 TGCTGCCTGAAAACAACACAGGG + Intergenic
938583985 2:132670957-132670979 TCCTACCAGAAAGCAAATCAGGG + Intronic
940506820 2:154566204-154566226 TCATATTAGAAAACAACATCAGG - Intergenic
940592316 2:155745193-155745215 AACTACTAGAAAAAAACAGAGGG + Intergenic
940698432 2:157010244-157010266 AACTACTAGAAGAAAACACAAGG + Intergenic
940749300 2:157606910-157606932 AACTACTAGAAGAAAACACAGGG - Intronic
941138573 2:161747310-161747332 TCACAGCAGAAAACAACACAAGG - Intronic
941237926 2:162998228-162998250 TCCTGATAGACAAAAACACAAGG - Intergenic
942021492 2:171870787-171870809 TGCTTCTAGGAAACAAGACAGGG + Intronic
942434373 2:175955956-175955978 TCCTCCTAGAAAACAATAGGAGG + Intronic
942889834 2:180976668-180976690 TCCTACTAGAAATGGACAAAGGG + Intronic
943302619 2:186223052-186223074 TCACACTAGAAAACAATACAGGG + Intergenic
943619516 2:190132676-190132698 AACTACTAGGAAAAAACACAGGG + Intronic
944150979 2:196558510-196558532 TCTTCATAGAAAACAACACCAGG + Intronic
945655603 2:212619441-212619463 TTTTACAGGAAAACAACACAAGG - Intergenic
947279451 2:228433417-228433439 TTATGCTAGAAATCAACACAAGG - Intergenic
947652350 2:231797603-231797625 TTCTACTAGTAAACATCCCATGG - Intronic
1169748526 20:8967573-8967595 TCTAACTGGAAAACAATACAGGG + Intronic
1169855425 20:10096709-10096731 AACTACTAGAAAAAAACACAAGG + Intergenic
1169862375 20:10166300-10166322 TCCTACTAGAAAATTACGGATGG + Intergenic
1170479127 20:16747471-16747493 TTCTAATAGAAAGCAACACTTGG + Intergenic
1170797016 20:19556810-19556832 TCTAACTAGAAAACAACACCAGG + Intronic
1170797113 20:19557582-19557604 TCTAACTAGAAAACAACACCAGG - Intronic
1172214663 20:33226825-33226847 TCCTACTGGAAAAAATCCCATGG + Intronic
1172218913 20:33258568-33258590 TGTTACTAGAAATCAAAACAGGG - Intergenic
1173767420 20:45625563-45625585 AACTACTAGAAGAAAACACAGGG - Intronic
1181428571 22:22861256-22861278 AACTACTAGAAGAAAACACAGGG + Intronic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1183913830 22:41100424-41100446 TACTCCTAGAAAACAACATTTGG - Intronic
949623095 3:5837964-5837986 TCATACTGGAAAGCAACACAGGG - Intergenic
949633677 3:5958283-5958305 ACCTCCTAGAAGACAACAAAGGG - Intergenic
949778405 3:7657565-7657587 TCCTACTGGAAAAAAAAAGAAGG - Intronic
949861007 3:8504713-8504735 TCCTAATAGAAAAAAAAAGATGG - Intronic
950728192 3:14933113-14933135 TCCACCTATAAAACAAAACAGGG - Exonic
950805225 3:15596423-15596445 GCCTACGAGAAAACAACACTGGG + Exonic
950857692 3:16120911-16120933 TCCTCCTAGTCATCAACACAGGG - Intergenic
951236959 3:20247756-20247778 TCCTTCTACAAAAAAAGACATGG - Intergenic
951437215 3:22678581-22678603 TCCTACCTGAAAAAAATACACGG + Intergenic
952361189 3:32631680-32631702 ACCAAATATAAAACAACACAAGG + Intergenic
954486667 3:50859514-50859536 TCCTACAAAAAAACCACACCGGG - Intronic
955174174 3:56596692-56596714 ACCTACTAGAAGAAAACATACGG - Intronic
955216495 3:56988627-56988649 TCCTAGTAGGGAACAACACTGGG - Intronic
957027801 3:75204343-75204365 AACTACTAGAAGAAAACACAGGG - Intergenic
957559815 3:81808877-81808899 TCCTGCCAGAAAATAACAAAAGG - Intergenic
958960912 3:100508860-100508882 AACTACTAGAAGACAACATAGGG + Intronic
958981862 3:100730427-100730449 CCATACAAGAAAACAACATATGG - Intronic
960348681 3:116567008-116567030 TTCTACTAGGAAACAACTCCTGG - Intronic
960391800 3:117085906-117085928 TCCTACTACATAACAAGAAAAGG + Intronic
960493389 3:118345919-118345941 TACTACTAGAAGAAAACACAGGG - Intergenic
960624181 3:119664371-119664393 TTCCACGAGAAAACATCACAGGG + Intronic
960892483 3:122464262-122464284 TCTTACTAGTAAATAAGACAAGG + Intronic
961641389 3:128366799-128366821 TCTTTCTAGAACCCAACACAAGG - Intronic
962472561 3:135725059-135725081 AACTACTAGAAGAAAACACAAGG - Intergenic
962496041 3:135939711-135939733 AACTACTAGAAAAGAAAACACGG - Intergenic
963628597 3:147705679-147705701 TGCTACAGGAAAACAGCACAAGG + Intergenic
964834123 3:160918448-160918470 TTCTATTAGAAACCATCACATGG + Intronic
965297257 3:166964573-166964595 ACCTACTAGAAGAAAACATAAGG - Intergenic
966339613 3:178911033-178911055 TCCCACTTGAAAAGCACACAGGG - Intergenic
967202861 3:187089261-187089283 AACTACTAGAACAAAACACAGGG - Intergenic
968096090 3:195931815-195931837 TCACAGTGGAAAACAACACAGGG + Intergenic
970938701 4:21605983-21606005 TCCAAAGAGAAAACAACAGAAGG - Intronic
971295724 4:25388754-25388776 TCTTACTTGAAAACAAGAAAAGG - Intronic
972547151 4:40091058-40091080 ACATACTAGCAAAAAACACATGG - Intronic
973059845 4:45709142-45709164 ACATACAAGAAAACAAGACATGG + Intergenic
974435655 4:61854256-61854278 TCCTACTAGAAAACAACACATGG - Intronic
974585952 4:63877651-63877673 TCATACCAGAAAAAAACACATGG + Intergenic
974868058 4:67604121-67604143 TCACAGTAGAAAGCAACACAGGG - Intronic
975506147 4:75140466-75140488 TCCCATGAGAAAAAAACACATGG + Intergenic
976071584 4:81246573-81246595 TCCTACTAGAAATATAAACAGGG + Intergenic
976073214 4:81265936-81265958 AACTACTAGAAGAAAACACATGG - Intergenic
976155888 4:82144501-82144523 TCCTACTACAAAATAAAGCAGGG + Intergenic
976611213 4:87032568-87032590 GGCTCCTAGCAAACAACACATGG - Intronic
978028203 4:103904569-103904591 TGCTACTAGAAAAAAACACACGG - Intergenic
978789495 4:112645838-112645860 TCCTATTAGAAACAAGCACAAGG - Intronic
978946406 4:114503579-114503601 AACTACTAGAAGAAAACACAAGG - Intergenic
979184528 4:117772117-117772139 TCACACTGGAAAACAACAGAGGG + Intergenic
982909181 4:161117861-161117883 TCTTACTGGAACAGAACACATGG - Intergenic
984728534 4:183044331-183044353 AACTACTAGAAAATAACATAAGG + Intergenic
984795223 4:183654107-183654129 TAGTACTAGAAAAAAATACACGG + Intronic
985428242 4:189851743-189851765 AACTACTAGAAAAAAACATAGGG - Intergenic
986886127 5:12238705-12238727 TTCTACTAGAACAGAGCACAGGG - Intergenic
987986123 5:25148523-25148545 AACTACTAGAAGAAAACACAGGG + Intergenic
988064586 5:26218401-26218423 TCACAGTGGAAAACAACACAGGG + Intergenic
988265422 5:28942615-28942637 TCACAGTAGAAAGCAACACAGGG - Intergenic
992533987 5:77679931-77679953 TCCTACTTTGAAACAACTCATGG + Intergenic
993423147 5:87727873-87727895 TTCAACTAGAAAACTAAACATGG - Intergenic
993990743 5:94655035-94655057 AACTACTAGAAGAAAACACAGGG - Intronic
994337670 5:98587481-98587503 TAGTATTAGAAAACAACATAAGG - Intergenic
995843861 5:116472104-116472126 TCATACTTTAAAAAAACACATGG + Intronic
997188897 5:131911397-131911419 TCCTAATAGTAAACTACATAAGG + Intronic
997331954 5:133070353-133070375 ACCTGCAAGAAAACAACAAAGGG - Exonic
997776544 5:136613038-136613060 AACTACTAGAAAAAAACATAGGG + Intergenic
998550368 5:143071519-143071541 AACTACTAGAAGAAAACACAGGG + Intronic
1002009887 5:176270721-176270743 TCACAGCAGAAAACAACACATGG + Intronic
1004993000 6:21160255-21160277 TCCCATTCGAAAACAACAGATGG - Intronic
1005267088 6:24123475-24123497 CCCTTCTGGAAAACAACCCAGGG + Intergenic
1007056438 6:38890407-38890429 CCCTACAAGAAAAAAATACAAGG - Intronic
1007229120 6:40336027-40336049 TCCTAGTATAGAACTACACAGGG + Intergenic
1008011166 6:46469284-46469306 TCTTTCTTGTAAACAACACATGG - Intronic
1008977390 6:57443863-57443885 AACTACTAGAAGACAACATATGG - Intronic
1009165525 6:60336814-60336836 AACTACTAGAAGACAACATATGG - Intergenic
1009215839 6:60918992-60919014 TGCTACTAAAAAACAACTTACGG + Intergenic
1009940003 6:70280563-70280585 TCCTCCTAGAAAACAGCAGCGGG - Intronic
1010190532 6:73191276-73191298 TGCAACCAGGAAACAACACAAGG - Intronic
1010346868 6:74821266-74821288 AACTACTAGAAAACAACATAGGG + Intergenic
1011172799 6:84524763-84524785 TTCTACTTGTTAACAACACAAGG - Intergenic
1011237707 6:85236053-85236075 GCCAACTTGAAACCAACACAGGG - Intergenic
1011302779 6:85893797-85893819 ACCTACTAGAAGAAAACATAGGG - Intergenic
1011330084 6:86194840-86194862 CACTACTAGAAAACAACATAGGG + Intergenic
1011389624 6:86837711-86837733 ACCTACTATAAAAAAACATATGG - Intergenic
1011538323 6:88402509-88402531 TTCTACTATCAAACAACACCTGG + Intergenic
1012666598 6:101978625-101978647 TTCTACCAGAAAAAAACACAGGG - Intronic
1013653223 6:112217822-112217844 TTCCACTAGAAAACAAGAGAGGG + Intronic
1013669286 6:112381357-112381379 TCCTGCTAGAAAATTAAACAGGG - Intergenic
1014537657 6:122634561-122634583 TCCTACTAGAACACAACTCCAGG + Intronic
1015194058 6:130506043-130506065 CCCAACTAGAAAATAACCCAAGG + Intergenic
1015871419 6:137780079-137780101 CCCTAATACAAAACAACACATGG - Intergenic
1016452714 6:144199690-144199712 TCTTGCTAGCAAAAAACACAAGG + Intergenic
1017105228 6:150881186-150881208 AACTACTAGAAGAAAACACAGGG - Intronic
1017228499 6:152047137-152047159 TTCTACTAGAAAATAAAACAGGG - Intronic
1017887736 6:158612732-158612754 TACTAATAAAAAATAACACATGG - Intronic
1020598718 7:10246312-10246334 TCCTACTATATACCAAAACATGG + Intergenic
1020761657 7:12274613-12274635 AACTACTAGAAGAAAACACAGGG - Intergenic
1020949320 7:14654921-14654943 AACTACTAGAAAAAAACAGAGGG + Intronic
1021953986 7:25805433-25805455 TCCTGCTAGAAACCAACTCATGG + Intergenic
1023621758 7:42080543-42080565 TTCTACTAATAACCAACACAAGG - Intronic
1024431775 7:49296668-49296690 TCCTACCAGTAAACAACACAGGG - Intergenic
1024727647 7:52216725-52216747 TAATACTAGACCACAACACATGG - Intergenic
1025474359 7:60900944-60900966 TAGTACCAGAAAAGAACACATGG - Intergenic
1025512644 7:61588930-61588952 TAGTACCAGAAAAGAACACATGG + Intergenic
1026377907 7:69770704-69770726 ACCTACTAGAGGACAACAGAAGG + Intronic
1030868601 7:114730073-114730095 GAATACTAAAAAACAACACAAGG - Intergenic
1031259975 7:119506525-119506547 TCACAGCAGAAAACAACACAGGG + Intergenic
1031556672 7:123185380-123185402 AACTACTAGAATACAAAACAGGG - Intronic
1031697217 7:124873253-124873275 ACCTACTAGAAGAAAACATAGGG - Intronic
1034912927 7:155012182-155012204 TCCTACAGGAAAGCAACCCATGG + Intergenic
1035035976 7:155893997-155894019 TTTTATTAGAAAACAAGACAAGG - Intergenic
1036591029 8:10168273-10168295 TCCACATATAAAACAACACAAGG - Intronic
1037525408 8:19719610-19719632 TCCCAGTAAGAAACAACACAGGG - Intronic
1038225080 8:25648438-25648460 AACTACTAGAAGAAAACACAGGG - Intergenic
1039751558 8:40483240-40483262 TCCTATTAGAAAACAAAGCCTGG - Intergenic
1039984806 8:42438203-42438225 TGTTTCTAGAAACCAACACAAGG + Intronic
1040547909 8:48415259-48415281 TCCCACTCAAGAACAACACAAGG + Intergenic
1041023765 8:53663556-53663578 AACTACTAGAAAACAACACAGGG - Intergenic
1041866149 8:62576008-62576030 AACTACTAGAAGACAACACTAGG + Intronic
1043438908 8:80259907-80259929 TCCTACTGGGCAACATCACAGGG - Intergenic
1045171255 8:99671568-99671590 AACTACTAGAAGAAAACACAGGG - Intronic
1045337390 8:101220098-101220120 AACTACTAGAAAAAAACACAGGG + Intergenic
1046022120 8:108678017-108678039 TCCTGCTTGAAATCTACACATGG - Intronic
1046491940 8:114965131-114965153 TCTTACTAGAAAACCAAGCAGGG - Intergenic
1046920033 8:119718295-119718317 TCATCCTACCAAACAACACAAGG + Intergenic
1048013412 8:130476911-130476933 TCCTGCTTGCAAACTACACAAGG + Intergenic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1050229591 9:3507041-3507063 TTCTACTAGAAAAAGACACTGGG + Intronic
1050708085 9:8426724-8426746 TCCCACAAGAAAAAAACAAAAGG + Intronic
1050735748 9:8760786-8760808 TCCCACAAGAAAAAAACAAAAGG + Intronic
1050912741 9:11093819-11093841 TCCTACAAGACAAGAACAAAAGG - Intergenic
1050923054 9:11230019-11230041 TACTAACAGAAAATAACACATGG - Intergenic
1051091352 9:13412707-13412729 TCCTACCATGAAACTACACATGG - Intergenic
1051384210 9:16489992-16490014 TTCTGCAAGAAAACAATACACGG + Intronic
1052271579 9:26633398-26633420 TCCTACAAGAAAAGTATACAGGG - Intergenic
1055368648 9:75573272-75573294 AATTACTAGAAAACAAAACACGG + Intergenic
1057585602 9:96325812-96325834 TCCTGCTAGAATTCAACACTCGG + Intronic
1057791691 9:98128821-98128843 TCCTCCCAGAAAACAGCTCAGGG + Intronic
1059092818 9:111378974-111378996 TCCTACTATAAATAAATACATGG - Intronic
1059482872 9:114605618-114605640 TCCTACTTGAAAATAACTTACGG + Intergenic
1059846608 9:118285316-118285338 ACCATCTAGAAAGCAACACAAGG + Intergenic
1060062333 9:120472062-120472084 TCCTACTACCAACTAACACACGG + Intronic
1061401150 9:130369187-130369209 TCCTGCTAGAAAATAAAACCAGG + Intronic
1186087374 X:6005008-6005030 TCCAGCAAGAAAACAACACTTGG + Intronic
1186476859 X:9864378-9864400 TTCTACTAAAAAACAACCCATGG + Intronic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1186650008 X:11549040-11549062 AACTACTAGAAGAAAACACAGGG + Intronic
1188222009 X:27552395-27552417 AACTACTAGAAGACAACATAGGG - Intergenic
1188724349 X:33563294-33563316 AACTACTAGAATAAAACACAGGG + Intergenic
1189049119 X:37625477-37625499 CCATAATAGAACACAACACAGGG + Intronic
1189247279 X:39572851-39572873 TCCTAAGATAAAACAGCACAAGG - Intergenic
1189455002 X:41178809-41178831 AACTACTAGAAGAAAACACAAGG - Intronic
1189579276 X:42388706-42388728 CTCTACTAGAAAACACCACCTGG + Intergenic
1191691363 X:63942042-63942064 AACTACTAGAAAAAAACATAGGG + Intergenic
1192023191 X:67418257-67418279 AACTACTAGAAAACAACCTAGGG + Intergenic
1192036624 X:67569512-67569534 TCCCACTAGCAAAGCACACAGGG - Intronic
1192745664 X:73935962-73935984 TCTTACTTGAAAACAAGATAAGG + Intergenic
1194093700 X:89609299-89609321 TTCTACTAGAAGAAAACATAGGG + Intergenic
1194412591 X:93575438-93575460 TCCTACTAGAAACCAGTACTTGG + Intergenic
1194492436 X:94568424-94568446 TCCCAGTGGAACACAACACAGGG - Intergenic
1196050552 X:111299343-111299365 TACTACTAGAAAATACCAAATGG - Exonic
1197166801 X:123386556-123386578 ACCTACTAGAAGAAAACATAGGG - Intronic
1197497169 X:127198769-127198791 TACTACTAGAAAAAAACATTGGG + Intergenic
1198326147 X:135575414-135575436 TCCTACTAGTACTCAATACATGG - Intronic
1199752486 X:150833820-150833842 AGCTACTAGAAAAAAACACAGGG + Intronic
1199781370 X:151063613-151063635 AACTACTAGAAAAAAACATAGGG - Intergenic
1200316518 X:155137924-155137946 TCCTCCTAGAAACATACACAGGG - Intronic
1200335331 X:155345112-155345134 ATCTACTAGAAGAAAACACATGG - Intergenic
1200351137 X:155496109-155496131 ATCTACTAGAAGAAAACACATGG + Intronic
1200387813 X:155911035-155911057 ACCTACTAGAAGAAAACATAGGG - Intronic
1201353147 Y:13068675-13068697 TACTAAGAGAAAATAACACATGG + Intergenic