ID: 974436864

View in Genome Browser
Species Human (GRCh38)
Location 4:61867789-61867811
Sequence AAATATGCACAGTTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974436864 Original CRISPR AAATATGCACAGTTTGAGGA TGG (reversed) Intronic
905990102 1:42329536-42329558 AAAAATTCACAGTTAAAGGAAGG + Intronic
906564554 1:46789505-46789527 AAACACCCACAGTTTGTGGAGGG + Intronic
909216530 1:72898134-72898156 AAATGTGTACAGTTTTAGCAAGG - Intergenic
910434543 1:87191833-87191855 AAAAATGCACAGATTGTGGAGGG - Intergenic
910706250 1:90132633-90132655 AAATATAGACCGTTTGAGCAGGG + Intergenic
912132122 1:106616460-106616482 AAATGCATACAGTTTGAGGAGGG + Intergenic
914901672 1:151714505-151714527 AATTATGCTCAGTGTCAGGAGGG + Intronic
915543912 1:156585141-156585163 GAAGATGAAGAGTTTGAGGAGGG + Exonic
916215914 1:162394435-162394457 AAATAGACACAGTGTGAGAAAGG + Intergenic
917927692 1:179802941-179802963 AGATGTGCACTGTTTGAGAAGGG - Intronic
919881457 1:201903783-201903805 AAATGTGCACATTTTGGGAAAGG - Intronic
921057143 1:211551530-211551552 CAATATCCACATTTTGAGGAAGG - Intergenic
921427250 1:215018619-215018641 ATATGTGCACAGTATGAAGATGG + Intronic
921472251 1:215563423-215563445 GACTATTCACAGTTTGTGGATGG - Intergenic
921515028 1:216080121-216080143 AAAGATACACAGTTTGGGGATGG + Intronic
921516517 1:216098900-216098922 AGGTATGGAAAGTTTGAGGAAGG + Intronic
922871694 1:228907385-228907407 AAACACGCACAGTTTGGGGAAGG + Intergenic
923861233 1:237894020-237894042 AAATATGACCAGATTGAAGAAGG - Intergenic
924534444 1:244922404-244922426 AAATATGTACAGTTTAAGTGAGG - Intergenic
1063705306 10:8424725-8424747 ACATCTGCACAGTCTGAGGCAGG + Intergenic
1063748066 10:8908846-8908868 AAATATGGAAAGAATGAGGAAGG - Intergenic
1065746648 10:28848432-28848454 AATTTTTCACAGTTTGAGGGAGG - Intronic
1068193615 10:53686944-53686966 AAACATGGACATTTTGGGGAAGG - Intergenic
1070354680 10:75628350-75628372 AAAAATGCTAAGTTTGAGGGTGG + Intronic
1072101319 10:92232014-92232036 CAATATGAAAAGTTTGAGGCTGG - Intronic
1073950443 10:108802959-108802981 AAATAAGGAAAGTTAGAGGAAGG + Intergenic
1074517524 10:114184407-114184429 TAATAAGCACAGCCTGAGGATGG - Intronic
1077677575 11:4209945-4209967 AAATATACACAGGTTAAGTATGG + Intergenic
1078745184 11:14106867-14106889 GAATATGCACAGACTCAGGAAGG - Intronic
1085660989 11:78366626-78366648 GAATATGCACAAAGTGAGGATGG + Intronic
1086013062 11:82129024-82129046 AAATATGCTCAGATTTAGGCTGG + Intergenic
1086886106 11:92207461-92207483 AATTTTGCTCAGTTTGAAGATGG + Intergenic
1087220617 11:95542803-95542825 AATCATGCTCAGTTTGAGTAGGG + Intergenic
1087278592 11:96185018-96185040 AAATCTAAACAGTATGAGGAAGG - Intronic
1087284181 11:96246782-96246804 TAATATATACAGTTTGAGGTTGG + Intronic
1087356942 11:97105965-97105987 AAATATGCACTGTTTTAGATAGG - Intergenic
1087788574 11:102383468-102383490 AAATATGCAAAGTTGGAGAATGG + Intergenic
1092059396 12:5536192-5536214 AAAGATGCATAGGATGAGGATGG - Intronic
1095261890 12:40106596-40106618 AAATAAGCATAAATTGAGGAGGG - Intergenic
1096961558 12:55583478-55583500 AAATATGCACAGTATGAACCTGG - Intergenic
1097729047 12:63106892-63106914 AAAAATGAACATTTTCAGGAAGG - Intergenic
1098652654 12:72992577-72992599 AAACATGCACAGCATGATGATGG + Intergenic
1099201506 12:79683184-79683206 AAATATGCACAGTTTTAAATTGG + Intronic
1099711581 12:86232608-86232630 AAACATGAACAGATTGAGAAGGG + Intronic
1100827525 12:98488828-98488850 AAAAAGGCACAGTTTGAGGGTGG + Intronic
1102185400 12:110943868-110943890 AAATATGTACAGTATGGGGGCGG - Intergenic
1104255465 12:127133195-127133217 AAATATGAACTCCTTGAGGAAGG + Intergenic
1107531031 13:41282478-41282500 AAATGTGCACAGTTTCAGACAGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110160241 13:72368254-72368276 AAAAATGCATTGTTTGAGGTTGG - Intergenic
1110321758 13:74168259-74168281 CAATATGCACAGCTTTAGCAAGG + Intergenic
1110321863 13:74169669-74169691 TAATTTACACAGTATGAGGATGG - Intergenic
1111413376 13:87906918-87906940 AAATATCCATAGTTTAAGCAGGG + Intergenic
1111818335 13:93183072-93183094 AATTATGCACACTGTGAGGAGGG - Intergenic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1112593529 13:100786785-100786807 AAATATTCACAGTTTAAAGCAGG - Intergenic
1112695121 13:101939138-101939160 AAACATTCAGTGTTTGAGGATGG + Intronic
1112983561 13:105418125-105418147 AAATATACAAAGGATGAGGAAGG - Intergenic
1114216826 14:20663516-20663538 AGAGATGCACAGGTGGAGGAAGG - Intergenic
1115052479 14:29080273-29080295 AAATATGCCACGTTTTAGGAAGG - Intergenic
1116777328 14:49196018-49196040 TAATATGCCCAGTCTAAGGAGGG + Intergenic
1117125227 14:52616165-52616187 AAATATGCAATGTTTGAGACAGG - Intronic
1117669475 14:58092124-58092146 AAAAATGAACAGATTGAGGTGGG - Intronic
1118644683 14:67826374-67826396 AAAAATGTACAATTTGATGAGGG - Intronic
1119186704 14:72648219-72648241 AAATAAGGAGAGTGTGAGGATGG - Intronic
1120133298 14:80833101-80833123 AAATATGTACATTTTCAGGTTGG - Intronic
1202891271 14_KI270722v1_random:160528-160550 TAATTTGCCTAGTTTGAGGATGG + Intergenic
1124166029 15:27326557-27326579 AAATATACAAAGTGTGAAGAGGG - Intronic
1125061254 15:35427765-35427787 AAATAAGCACAGTCTTTGGAAGG + Intronic
1126124408 15:45282481-45282503 AAATATGCACATTTTTGTGATGG - Intergenic
1128551403 15:68600299-68600321 AAAGATGCAAACATTGAGGAAGG - Intronic
1130213747 15:81949506-81949528 GAATAAGCATAGTTTGGGGAAGG - Intergenic
1131897777 15:97052620-97052642 AAATATGCAGAATTTAAAGAGGG + Intergenic
1136053802 16:27672887-27672909 AAACATGGCCAGTTTCAGGAAGG - Intronic
1137941342 16:52689913-52689935 AAATATTTACAGTTGAAGGATGG - Intergenic
1143848293 17:9790044-9790066 CAATCTGCACGCTTTGAGGATGG - Intronic
1143887277 17:10074293-10074315 ATAAATGCAAAGTTTGTGGAGGG - Intronic
1146451594 17:32978901-32978923 AAAAATGCACAGGTTGGGGACGG - Intronic
1146966973 17:37039937-37039959 AAAAAGGCCCATTTTGAGGAAGG - Intronic
1148997791 17:51726506-51726528 AAATATGCTTATTTTGTGGATGG - Intronic
1149320578 17:55476932-55476954 AAATTTGCACATTTTCAGGGAGG + Intergenic
1149680183 17:58501042-58501064 AATTCTGCATAGTTTGGGGAAGG + Intronic
1151426286 17:74032942-74032964 AAATATGCTGAGTTTTAGGGGGG - Intergenic
1155446252 18:25915843-25915865 AAAAATGCACAGGGTGAGGCAGG - Intergenic
1155881493 18:31154769-31154791 AAATATGAACAGTTTGCGGTAGG - Exonic
1156744840 18:40377341-40377363 AAATATATCCAGTTTGAGGGAGG - Intergenic
1156945335 18:42822651-42822673 CAGGATGCACAGTTTTAGGAAGG - Intronic
1156993085 18:43433998-43434020 AAATATGAATATTTGGAGGAAGG + Intergenic
1157194786 18:45611859-45611881 AAATAAATTCAGTTTGAGGAAGG + Intronic
1158566448 18:58558046-58558068 AAATATGCCTAGTTTGAAGGAGG + Intronic
1158751434 18:60265819-60265841 AAATTTCCTCAGTTTGTGGAAGG + Intergenic
1159318814 18:66818525-66818547 AAACATGCACTGTTCGAAGATGG + Intergenic
1159857169 18:73602791-73602813 CAAGAAGCACAGTTTGAAGACGG - Intergenic
1164117853 19:22239473-22239495 AAAAATTCACAGTTTGGGGCAGG - Intergenic
1165432064 19:35778516-35778538 AAATATGCACCGGTGGAGGTGGG - Exonic
1168676265 19:58279847-58279869 AAAGTTGCAGAGCTTGAGGAAGG - Exonic
1202666690 1_KI270708v1_random:127373-127395 TAATTTGCCTAGTTTGAGGATGG + Intergenic
925317807 2:2938894-2938916 AATTCTGCACAGTTAGATGAAGG - Intergenic
925861243 2:8178335-8178357 AAATATGACCATTATGAGGAGGG + Intergenic
926300897 2:11601428-11601450 ATATGTGTTCAGTTTGAGGAAGG - Intronic
926717456 2:15936290-15936312 AAATGTACACATTTTGAGGGAGG + Intergenic
929200220 2:39227479-39227501 AAATATGCCCAGGCTGAGGCAGG + Intronic
930383629 2:50663192-50663214 AAATATGTATAGTATGTGGATGG - Intronic
930482330 2:51964664-51964686 AAATCTGCACAATTTGATAAAGG - Intergenic
930998259 2:57749076-57749098 AAAAATGCACAGTTTCATAAGGG + Intergenic
932936846 2:76113452-76113474 AAAAATGCAGAGTTTGAAAAGGG - Intergenic
935126862 2:100231831-100231853 AAATAAACAGGGTTTGAGGAGGG + Intergenic
935179900 2:100679884-100679906 AAATAAGCAGGGTTTGAAGAGGG + Intergenic
935660359 2:105461446-105461468 AAAGATGCAGAGTTTGGGCATGG + Intergenic
937370456 2:121293921-121293943 AAACTTGCACAGCTGGAGGACGG + Intergenic
937757121 2:125553475-125553497 GAATATACACAGTTTGAAGTGGG + Intergenic
937803833 2:126114217-126114239 TAATATGCACTGTTTTATGATGG - Intergenic
939825040 2:147003944-147003966 AAATATGTACAGAATGATGATGG - Intergenic
940438359 2:153682486-153682508 AAGTGTGCACAGTTTGCAGAGGG - Intergenic
941093707 2:161211274-161211296 AGATATGAACAGTGTAAGGATGG - Intronic
941414041 2:165196338-165196360 GAATATCCACATTTTGAGGCAGG - Intronic
942983008 2:182105202-182105224 AAATCAGCTGAGTTTGAGGAAGG + Intronic
943213297 2:184997444-184997466 AAATATGTACAGTTTGCTAAAGG - Intergenic
945131173 2:206574256-206574278 AAATATGTACAGGTTGAGCCAGG - Intronic
947079999 2:226385485-226385507 AAAAAAGCACAGTTGGAGGATGG - Intergenic
947612963 2:231535172-231535194 AAATATTCAGAGTGCGAGGAAGG + Intergenic
947984673 2:234438140-234438162 AAATAGGCACACAATGAGGAAGG - Intergenic
948082509 2:235218144-235218166 AAATATAAATATTTTGAGGAAGG + Intergenic
1169629768 20:7617647-7617669 ATATGTGCACAGTTTTAGAATGG - Intergenic
1169975486 20:11322562-11322584 AGAGATTCACAGTTTGAGGGAGG - Intergenic
1169982863 20:11406223-11406245 AAAGATGGAAAGTGTGAGGATGG - Intergenic
1170220986 20:13941272-13941294 AAATGTGCACAGTCTCAGGCAGG - Intronic
1170502782 20:16991837-16991859 AAATATGCATACATTGTGGAAGG + Intergenic
1172510241 20:35495772-35495794 AAAAAGACACAGTTTGAGAAGGG + Intronic
1173346095 20:42201470-42201492 AAATGAGGACAATTTGAGGAAGG + Intronic
1174059233 20:47820927-47820949 GAATATGCACAGGGTGTGGACGG + Intergenic
1175910059 20:62400939-62400961 AGATCTGCACAGTTCTAGGAAGG + Intronic
1177399597 21:20585605-20585627 AAATTTCCTCAGTTTGAGAAAGG + Intergenic
1177439576 21:21103869-21103891 AAACATGCAGAGTTTAAAGATGG + Intronic
1177902814 21:26937676-26937698 AAATGTATACAGTTTGGGGAAGG + Intronic
1178274275 21:31222480-31222502 ATATATGCATTGCTTGAGGAAGG - Intronic
1178282836 21:31298197-31298219 AAATATGCATAGTTATTGGAAGG - Intronic
1178455389 21:32745294-32745316 AATTATACAGAGTTTGAGGGAGG - Intronic
1180651079 22:17377693-17377715 AAATATGCAAATATGGAGGAAGG - Intronic
1182012148 22:27010052-27010074 AGCCATGCCCAGTTTGAGGATGG + Intergenic
949333653 3:2949991-2950013 GAATATCTACAATTTGAGGAAGG + Intronic
949388546 3:3533343-3533365 AAAGATGAACAGTTTGAGCACGG - Intergenic
950535744 3:13577236-13577258 AAAAAAGCACAGTGAGAGGAAGG + Intronic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
953242708 3:41163843-41163865 ACAAATGCACAATTTGAGTACGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954126161 3:48531074-48531096 AAATATGGACAGGTTGGGCATGG + Intronic
954266125 3:49471491-49471513 AAAAATCCATAGTTTGAGTATGG + Intronic
956431571 3:69191730-69191752 AATTTTGCACAGTTTGAGGATGG + Intronic
956528435 3:70190176-70190198 AAATAAGAAGAGTTTGAGAAAGG + Intergenic
956684750 3:71815535-71815557 TAATATGCACAGTGATAGGAAGG + Intergenic
957089195 3:75712197-75712219 TAATTTGCCTAGTTTGAGGATGG - Intronic
957140348 3:76346957-76346979 ATATAAGCACAGCTTGAAGAAGG + Intronic
957563296 3:81853943-81853965 ATATATGCACAGAATGAGTAAGG + Intergenic
958135926 3:89490797-89490819 AAAATTTCACAGTTTGGGGATGG - Intergenic
959550817 3:107655042-107655064 AAAAATGTACAGTTTGAAGCCGG - Intronic
960147906 3:114222469-114222491 AAGTATGAACAGTGTTAGGAGGG - Intergenic
960191295 3:114709573-114709595 AAATAACCACAGCTTTAGGAGGG + Intronic
960822047 3:121744713-121744735 AAATATGTACATTTTAAGAAAGG + Intronic
962944011 3:140151180-140151202 AAATATAAACAGCTTCAGGAAGG + Intronic
963054815 3:141177470-141177492 GAATATGCTCAGTTTGAGAGAGG - Intergenic
963193450 3:142499588-142499610 AAATATAAGCAGTTTTAGGATGG - Intronic
963952015 3:151212844-151212866 AAGCAGGCACAGTTTGATGAAGG - Exonic
964811216 3:160666782-160666804 ATATATGCACAGTTTCTGTATGG - Intergenic
965385179 3:168037002-168037024 TAAATTGCACAATTTGAGGAGGG + Intronic
967885210 3:194328965-194328987 AAAAATGATCAGTTGGAGGAAGG - Intergenic
969963535 4:10971257-10971279 AAATATACACAGTATGAGGCAGG + Intergenic
970746712 4:19306995-19307017 ATATATACTCATTTTGAGGAAGG + Intergenic
971000398 4:22316280-22316302 GAATATGAGCAATTTGAGGAAGG + Intergenic
972257201 4:37369879-37369901 AAATATGCACAGATATGGGATGG + Intronic
972459447 4:39287111-39287133 AAATATGCCCTTTATGAGGATGG - Intergenic
972617435 4:40713284-40713306 AAACATGCAGAGTTGGAGGGAGG + Intergenic
973728230 4:53797352-53797374 AGGCATGCACAGTTTGAGGGTGG - Intronic
973998592 4:56485806-56485828 AAAAAAGCACATTTTGAGGTTGG + Intronic
974082621 4:57228397-57228419 AAAAATGGGCAGTTTGAGCAGGG - Intergenic
974436864 4:61867789-61867811 AAATATGCACAGTTTGAGGATGG - Intronic
976867071 4:89741868-89741890 ACCTGTGCACAGTTTGAGAAAGG - Intronic
978262466 4:106776801-106776823 AACTATGCTCAGCTTGAGAAAGG - Intergenic
978402362 4:108344074-108344096 ACCTATGGACACTTTGAGGAAGG - Intergenic
979180189 4:117716523-117716545 AAGTATGCACAGTTTGTGATGGG - Intergenic
979340400 4:119515870-119515892 ATAAATGCACAGTTTTAGGAAGG - Intronic
979947525 4:126851911-126851933 ATATTTGCGCAGTTTGAGTAAGG - Intergenic
981158603 4:141470538-141470560 AAATATGAACATTTTGTGGAAGG - Intergenic
981268083 4:142811172-142811194 ATATATGCACAGGTGGAGGTAGG - Intronic
981278431 4:142929061-142929083 AAATATGAACAATCTGGGGAAGG + Intergenic
982964466 4:161886257-161886279 AAATGTCCACACTTTGAGAAGGG - Intronic
984449347 4:179879087-179879109 AAATAAGAACAGATTCAGGAAGG + Intergenic
984836961 4:184031405-184031427 AATAATACACTGTTTGAGGAAGG + Intergenic
985869644 5:2544160-2544182 AAGTTTGCACACTTTGAGAACGG + Intergenic
986565884 5:9113520-9113542 AAATATGCATACATTGTGGATGG - Intronic
986908420 5:12523254-12523276 AAATATAAATAATTTGAGGAAGG + Intergenic
987512483 5:18857508-18857530 ATACATGCACAGTATTAGGAAGG + Intergenic
987631043 5:20472052-20472074 AAATATGCACATATTAAAGACGG - Intronic
987972234 5:24962119-24962141 GAATATGCATAGTGTGAAGAAGG + Intergenic
988191592 5:27943956-27943978 GAAGAAGCACAGTTTGAGGTGGG - Intergenic
990054915 5:51561858-51561880 ATATATGAACAATTTGATGATGG + Intergenic
992885819 5:81159219-81159241 AAATATGCTAAGTTAGAGGTTGG + Intronic
993294694 5:86121288-86121310 AAATCTGCACAGGTAGATGAAGG - Intergenic
993750928 5:91666522-91666544 AAATATGGACAGGTAGAGGAAGG + Intergenic
996672453 5:126134559-126134581 AGATTTGAAGAGTTTGAGGAAGG - Intergenic
996848931 5:127931492-127931514 CAATATGCACAGCTGGAGGAGGG - Intergenic
997387944 5:133488575-133488597 AAATCTACACAGATTGATGACGG + Intronic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998567445 5:143228424-143228446 AAATATGAACAGTTTTAAAATGG - Intronic
1000188304 5:158882583-158882605 AAATATGCAAAGTTTCTCGAAGG + Intronic
1004659254 6:17695683-17695705 AAATATGCACAGTATTGGAAAGG + Intronic
1005116322 6:22341967-22341989 AAACATGCACACTTTGGGTATGG - Intergenic
1007294402 6:40810898-40810920 AAGTAGGCACACTTTAAGGATGG - Intergenic
1008023442 6:46606432-46606454 AAGTATGCACAGTATGGGTACGG - Intronic
1008785928 6:55168026-55168048 AAATATTCACTGTTTGAAGAAGG + Intronic
1009744733 6:67798279-67798301 AAATCTGTGCACTTTGAGGAGGG + Intergenic
1011210055 6:84945612-84945634 AAATATCCAAACTTTGTGGAAGG - Intergenic
1012862150 6:104572800-104572822 AAATATGAACATATTGAGAAAGG + Intergenic
1013629934 6:111976556-111976578 AAATATACACAGTTAGAGAGAGG - Intergenic
1014617124 6:123617035-123617057 AAATATGATCTGTTTGAGGTAGG - Intronic
1014836883 6:126169759-126169781 AGATTTGCACAGTTCTAGGAAGG - Intergenic
1014911134 6:127094186-127094208 AAATATGTACAGTTTAAGCCCGG - Intergenic
1016641544 6:146354840-146354862 TAATACACACAGTATGAGGAAGG + Intronic
1016693777 6:146968814-146968836 AAATAGCCACAGTTTGAGAATGG + Intergenic
1016770050 6:147839110-147839132 AAATATGGGCAGTGTGAGAAAGG - Intergenic
1018352068 6:162970298-162970320 GAATGAGCACAGTCTGAGGAGGG + Intronic
1018386584 6:163309870-163309892 AAATAGGCACGATTTCAGGAAGG - Intronic
1018523172 6:164676143-164676165 ATATATGAACATTTTGAGGATGG - Intergenic
1020019871 7:4858255-4858277 AAAAGTGCAGAGTTAGAGGAGGG + Exonic
1020733588 7:11916501-11916523 AAAAATGCACAGATTGGGGCTGG + Intergenic
1021680840 7:23129595-23129617 CAATACCCACAGTTTGGGGACGG - Intronic
1023110975 7:36810308-36810330 AAAGATTCACTGTTTGGGGAGGG - Intergenic
1025235679 7:57233106-57233128 GAATATGCACAGGGTGTGGACGG - Intergenic
1026469588 7:70683798-70683820 AAATTAGCACAGTTTGTAGATGG - Intronic
1026776380 7:73233702-73233724 ATATGTGTACAGTGTGAGGAAGG - Intergenic
1027017232 7:74787072-74787094 ATATGTGTACAGTGTGAGGAAGG - Intronic
1027070791 7:75158860-75158882 ATATGTGTACAGTGTGAGGAAGG + Intergenic
1027575427 7:79924632-79924654 GCATATGCACAGTGCGAGGAAGG + Intergenic
1027904510 7:84162332-84162354 AAATGTGCAAAGGGTGAGGAAGG + Intronic
1027905913 7:84181131-84181153 ACATATACAAAATTTGAGGAGGG - Intronic
1028473145 7:91225988-91226010 AAATATGCTGGGTTTGTGGAAGG - Intergenic
1029560334 7:101298943-101298965 AAATATGCATTTTTTGTGGATGG - Intergenic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1032870069 7:135976129-135976151 ACAAAGGCACAGTTTCAGGATGG + Intronic
1033041083 7:137918817-137918839 GAATGTGCACACTTTGAGAATGG - Intronic
1034082860 7:148296648-148296670 GAAAATGCCCAGTTTTAGGATGG + Intronic
1034247738 7:149661615-149661637 AAATATGAACAGTCTGGGCATGG - Intergenic
1035005443 7:155654696-155654718 AAATATACACAATGTGATGAGGG - Intronic
1036280291 8:7394324-7394346 AAGAATTCACAGTTTGAGGCAGG + Intergenic
1036341236 8:7917559-7917581 AAGAATTCACAGTTTGAGGCAGG - Intergenic
1037671213 8:21016765-21016787 AAATATAGACAGTTGAAGGAAGG - Intergenic
1037706030 8:21315950-21315972 ATCTATGCACAGATTGAGGTTGG - Intergenic
1037760950 8:21741214-21741236 AGAGATGCACAGGTTGAGGTTGG - Intronic
1039318204 8:36396510-36396532 CAATATGCAGAGCTTGGGGAGGG + Intergenic
1039866310 8:41506458-41506480 AAATATGCACAGTATGTCAAAGG - Intronic
1042898267 8:73694779-73694801 AAATCTGTACACTTTGAGGGAGG + Intronic
1043310043 8:78847495-78847517 AAAACTGCACATTTTCAGGAAGG + Intergenic
1043783262 8:84363460-84363482 AAATATGCACTGTTTATGGAAGG - Intronic
1043848408 8:85188078-85188100 AAATATTCAAAATGTGAGGAGGG - Intronic
1044058691 8:87605521-87605543 AAATATGTACAGTTTTGGTAAGG + Intronic
1044107189 8:88223980-88224002 AAAGATGCACAGATTATGGAAGG + Intronic
1044210468 8:89544101-89544123 TAAGATGAACAATTTGAGGAAGG + Intergenic
1045285630 8:100789002-100789024 AACTATGAACACTTTGAAGATGG - Intergenic
1047158488 8:122349574-122349596 AGATATCTACATTTTGAGGATGG - Intergenic
1048028245 8:130606545-130606567 AAATATGAACATTTTGGGGGAGG - Intergenic
1049997728 9:1047572-1047594 AAATAAGTACATTTTGGGGAAGG - Intergenic
1050126230 9:2359032-2359054 AATTATGGACAGTTTGGGTAAGG - Intergenic
1050602344 9:7265725-7265747 AAAAAGGCACAGTTTCAGGCTGG + Intergenic
1051731105 9:20143824-20143846 AAATATTGACATTTTGATGATGG - Intergenic
1052096112 9:24386391-24386413 AAAGATGCACAGGATGACGAAGG + Intergenic
1053478887 9:38401535-38401557 AAATATGGAGGGTTGGAGGAAGG + Intergenic
1057762345 9:97886912-97886934 AAATAAGCACATTGTGAAGAAGG + Intergenic
1059039641 9:110798384-110798406 AAATATGCAGAATTTTAGAATGG + Intronic
1059589405 9:115641823-115641845 AAACAAGCATAGTTTGAGCATGG - Intergenic
1061388062 9:130302033-130302055 AAAAAAGCACAGCTAGAGGATGG - Intronic
1185851629 X:3494444-3494466 AAATATGCATACCTTGTGGAAGG + Intergenic
1187710498 X:22048684-22048706 CAATATGCTTTGTTTGAGGAGGG + Intronic
1187995136 X:24918107-24918129 CAAAAAGCAAAGTTTGAGGATGG + Intronic
1188681170 X:33007323-33007345 GAATATGTACACTCTGAGGAGGG - Intronic
1190079095 X:47341250-47341272 AAATATGCCCATTTTCAGGCTGG - Intergenic
1192017832 X:67350825-67350847 ATAGAAGCACAGTTAGAGGAGGG - Intergenic
1195695840 X:107666726-107666748 AAATAAGTTCAGTTTGAGGCAGG - Intergenic
1196337657 X:114557589-114557611 AAAAATGCACTTTATGAGGAGGG + Intergenic
1199541312 X:148960608-148960630 AAAGGTGCAAAGCTTGAGGAGGG - Intronic