ID: 974438937

View in Genome Browser
Species Human (GRCh38)
Location 4:61892692-61892714
Sequence CTACCACCAGTACCACCCTT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 115}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974438936_974438937 -4 Left 974438936 4:61892673-61892695 CCTCTTGGCATGGGAAGCACTAC 0: 1
1: 0
2: 0
3: 7
4: 83
Right 974438937 4:61892692-61892714 CTACCACCAGTACCACCCTTCGG 0: 1
1: 0
2: 2
3: 9
4: 115
974438935_974438937 4 Left 974438935 4:61892665-61892687 CCACAGGACCTCTTGGCATGGGA 0: 1
1: 0
2: 0
3: 16
4: 173
Right 974438937 4:61892692-61892714 CTACCACCAGTACCACCCTTCGG 0: 1
1: 0
2: 2
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974438937 Original CRISPR CTACCACCAGTACCACCCTT CGG Exonic
901071078 1:6518818-6518840 CTGCCACCAGAGCAACCCTTTGG + Intronic
903342887 1:22665625-22665647 CTGCCACCAGCACCACCCTTCGG - Intergenic
905652838 1:39668136-39668158 CCACCACCAACCCCACCCTTAGG - Intronic
909034437 1:70581150-70581172 CTACCAGCACTACCAGCCATGGG + Intergenic
910738340 1:90487460-90487482 CCACCACCAATATCAACCTTGGG - Intergenic
913101249 1:115569001-115569023 CTACCACCCTTTCCAGCCTTTGG - Intergenic
913438978 1:118877227-118877249 GCACCACCAGCAACACCCTTAGG + Intergenic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
921627619 1:217395233-217395255 CTACCACCATCACCACCCAAGGG + Intergenic
921666752 1:217881798-217881820 CTTCCTCCAGTAACCCCCTTGGG - Intergenic
924201172 1:241660281-241660303 CTTCTACCAGTACCATGCTTTGG + Intronic
1063408780 10:5820545-5820567 CTTCCACCAGTACCTTCCATTGG + Intronic
1065633771 10:27709762-27709784 CTCCCACCACCACCACCATTTGG + Intronic
1067520398 10:46996845-46996867 CTTCTGCCGGTACCACCCTTTGG + Intronic
1068030341 10:51698312-51698334 CTACCACCTCTACCATCCATAGG + Exonic
1071880391 10:89890658-89890680 CTCCCACCAGTGCCTCCCATTGG - Intergenic
1076049785 10:127323292-127323314 CACACACCAGCACCACCCTTAGG - Intronic
1083426238 11:62588261-62588283 CTGCTCCCAGTCCCACCCTTTGG - Intronic
1084520188 11:69658033-69658055 CTATCACCAGTCCCACCATAAGG + Intronic
1092382607 12:8010102-8010124 CTACCACCACCCCCAGCCTTCGG + Intergenic
1093053648 12:14532939-14532961 ATAACCTCAGTACCACCCTTAGG - Intronic
1093301252 12:17459724-17459746 CTACCACCACTGGCACCCTTTGG + Intergenic
1097248204 12:57618206-57618228 CTACATCCTGTACCCCCCTTAGG - Intronic
1098416480 12:70240887-70240909 CTTCCACTGGTACAACCCTTGGG - Intergenic
1099446436 12:82757668-82757690 CTACCAACATTTCCACTCTTTGG + Intronic
1100790533 12:98125281-98125303 CTACCACCAGTTCATCCTTTTGG + Intergenic
1101101000 12:101392479-101392501 CTACATCCTGTATCACCCTTAGG - Intergenic
1107237232 13:38186586-38186608 CTTCCAGCAGTAGCACCATTCGG + Intergenic
1108707940 13:53006932-53006954 CTACCACCACCACCAACCTATGG - Intergenic
1116135192 14:40914485-40914507 CCACCACCAGTACCACTAGTTGG - Intergenic
1118085020 14:62404532-62404554 CTACCACCCATGCCACCCTAAGG - Intergenic
1121750253 14:96348323-96348345 CTACTACCATTCCCACCCTCTGG - Intronic
1125274755 15:37978576-37978598 GTACCACCCTTACTACCCTTGGG - Intergenic
1126100694 15:45116682-45116704 GTACCACCAGTACCACCTGGCGG + Exonic
1129027680 15:72593680-72593702 CTTACATCAGTACCACACTTTGG + Exonic
1133312898 16:4861951-4861973 CAACCACCATTACCACCTTTAGG + Intronic
1133671908 16:8031091-8031113 CTCCCACCAGTCCCTCCCATGGG + Intergenic
1134385032 16:13763849-13763871 CTTCCATCAGTACCTCCCATTGG + Intergenic
1134812797 16:17181639-17181661 CTACCCTCAGTTCCTCCCTTTGG - Intronic
1135465539 16:22681613-22681635 GTACCCCCAGTCCCACCCCTGGG - Intergenic
1136002084 16:27302537-27302559 CTATCACCTGTACCACCCAGAGG - Intergenic
1137286415 16:47019751-47019773 ATACCAACAGTGCCACCATTTGG - Intergenic
1138217093 16:55214055-55214077 CTACCACGAGCACCACAATTTGG + Intergenic
1141722848 16:85766371-85766393 CTAACCCCAGTGTCACCCTTAGG - Intergenic
1146796015 17:35781597-35781619 CTATCACCAGTTCTACCCTTTGG + Intronic
1147661588 17:42119873-42119895 CTACCACCATGCCCACCCTGAGG + Intronic
1149321666 17:55487718-55487740 CCTCCAGCAGTATCACCCTTGGG + Intergenic
1151807917 17:76418080-76418102 CTACACCCAGTCCCACCCTGGGG + Intronic
1152282854 17:79395664-79395686 AGACCACCAGTCCCACCCGTTGG - Intronic
1156042588 18:32839549-32839571 CTGCCACCACCACCACCTTTTGG - Intergenic
1158696982 18:59712373-59712395 CTACCCCCCACACCACCCTTAGG - Intergenic
1162987334 19:14279324-14279346 CTCCCACCAGTACCTCCTTTTGG + Intergenic
1165592363 19:36980557-36980579 TTTCCACCACCACCACCCTTAGG + Intronic
1166074452 19:40405563-40405585 TGACCACCAGTACCGCCCTTTGG + Intronic
1166349716 19:42190509-42190531 CTACCACCTGGACCACAGTTAGG + Intronic
927104573 2:19812201-19812223 CTGGCACCAGAACAACCCTTCGG + Intergenic
927158985 2:20240897-20240919 CCACCACCACCACCACCCTTTGG + Intergenic
931915226 2:66947309-66947331 CTACCATCACTACCATCCATTGG + Intergenic
932893130 2:75613065-75613087 CTCCCACCAGCACCTCCCATTGG + Intergenic
935508200 2:103933489-103933511 CTACCACCAGCATCAGCCATCGG + Intergenic
937781921 2:125848481-125848503 CAACCCCCAGTACCAGCCTGGGG - Intergenic
937851432 2:126639571-126639593 CCAGCACAAGCACCACCCTTAGG - Intergenic
941223546 2:162815739-162815761 ATACAACCAGTACCACCTCTTGG + Intronic
941466270 2:165831233-165831255 CTACCACCAATACCACTGTGAGG + Intergenic
943920242 2:193698215-193698237 CCACCCCCAATCCCACCCTTTGG - Intergenic
944177575 2:196850082-196850104 CTACAACCACTGCCACCCTGTGG - Intronic
945654746 2:212609522-212609544 CTACCACCAGTACCTCCCATTGG + Intergenic
946776503 2:223148002-223148024 CTATCATCAGTAACATCCTTTGG + Intronic
947280334 2:228445484-228445506 GTCCTTCCAGTACCACCCTTTGG + Intergenic
947298812 2:228665112-228665134 AGACCACCAGTCCCACCCCTGGG - Intergenic
1168979631 20:1993655-1993677 CTCCCAAGAGGACCACCCTTTGG - Intronic
1169210499 20:3763927-3763949 GTACCACCAGGAGCCCCCTTTGG + Intronic
1175922289 20:62455865-62455887 CTGCCCCCAGCACCTCCCTTTGG + Intergenic
1177231628 21:18328501-18328523 CTACCACAAGCACTACCCATTGG - Intronic
1179413129 21:41177505-41177527 ATTCCACCAGTAATACCCTTGGG + Intronic
1181861967 22:25826105-25826127 CTACCACCATCACCACCACTAGG - Intronic
1182593609 22:31400710-31400732 CCTCCACCACCACCACCCTTTGG - Exonic
1185016897 22:48349494-48349516 CTCCCACCAGGACCCCCTTTTGG - Intergenic
952325893 3:32320463-32320485 CTCCCACCCCTACCACCCTCAGG - Intronic
952686840 3:36159970-36159992 CTAACACTAATACCACTCTTGGG - Intergenic
952689791 3:36191760-36191782 CAACCCCCAGTACCAGCCTGGGG - Intergenic
961989736 3:131175584-131175606 CTCCCACCACTACCACCCCCAGG - Intronic
965093645 3:164193731-164193753 CTCTCACCAGTTCCACTCTTGGG - Intergenic
967422765 3:189292381-189292403 TTATCAACAGTACCACCCTTTGG + Intronic
969989780 4:11250240-11250262 CACCCACCAGTTCTACCCTTTGG + Intergenic
970604017 4:17662665-17662687 CTACCAGCAGTTCCACTTTTAGG - Intronic
973803262 4:54499132-54499154 CTACTCTCATTACCACCCTTTGG + Intergenic
974438937 4:61892692-61892714 CTACCACCAGTACCACCCTTCGG + Exonic
974982254 4:68973108-68973130 CTAGTACCAGTGCCACTCTTTGG - Intergenic
974995213 4:69147543-69147565 CTAGTACCAGTGCCACTCTTTGG + Intronic
980892782 4:138832657-138832679 TTATCAGCAGTACCACCCTTTGG - Intergenic
981227447 4:142313476-142313498 TTTCCACTAGTACCACCCTGGGG - Intronic
984258851 4:177419938-177419960 CTACCTCCAAAACCACCTTTTGG - Intergenic
985670539 5:1204414-1204436 CTGCCCCCAGCACCACCCTCGGG - Intronic
988838901 5:35063880-35063902 CTACCACCACCACCAACCTAGGG - Exonic
989666826 5:43864181-43864203 TTAAGACCACTACCACCCTTAGG - Intergenic
996629789 5:125614551-125614573 CTACCACTAATACCACCTGTTGG - Intergenic
997516509 5:134493666-134493688 CCACCACCTCTACCACCCTGAGG + Intergenic
1001081878 5:168673138-168673160 CTACCACCTCTACCTCCCTCTGG - Intronic
1002023694 5:176382784-176382806 CTACCACTAGCCCCACCCCTAGG - Intronic
1006753006 6:36391131-36391153 CTACTACCACTAGCACCGTTGGG - Exonic
1006831247 6:36969537-36969559 CTGGCAGCAGTACCAACCTTGGG - Intronic
1007706680 6:43795449-43795471 CCACCACCAGCACCACCATTTGG - Intergenic
1010960135 6:82136528-82136550 CTGCCTCCATTATCACCCTTAGG + Intergenic
1015993822 6:138977762-138977784 CAACCAGCAGTTCCACTCTTAGG - Intronic
1017912206 6:158803076-158803098 CTTCCTCCAGCACCACCATTAGG + Intronic
1020397871 7:7737420-7737442 CTACCACCAGTTCTTACCTTTGG + Intronic
1026835679 7:73637654-73637676 CTACCATCAGTAAGAACCTTGGG - Intergenic
1030274989 7:107710835-107710857 GTACCACCAGGAGCACCATTAGG - Intronic
1032551538 7:132788881-132788903 GTACCACCCCTGCCACCCTTTGG - Intronic
1041192306 8:55366171-55366193 CTCCCACCAGTGCCACCTATTGG + Intronic
1043205867 8:77438372-77438394 CTACCCCCAGTGCCAGCCTGGGG - Intergenic
1044418579 8:91965046-91965068 CTACCACCACTCCCTCCTTTTGG + Intronic
1050108971 9:2195304-2195326 TTACCACCAGTCCCACCCGAAGG - Intergenic
1052973985 9:34398732-34398754 CTACCACCACCACCACCCCGGGG - Exonic
1056289602 9:85129333-85129355 CTCCCACCATTTCCACCTTTTGG + Intergenic
1056553479 9:87670679-87670701 CTTCCACCACTACCGCCCTCTGG + Intronic
1058132306 9:101266551-101266573 CACCTACCACTACCACCCTTTGG + Intronic
1058711394 9:107682245-107682267 CTCCCAGCAGGACCAGCCTTGGG + Intergenic
1059992564 9:119878904-119878926 CTACCACCAGCAGCAAGCTTAGG + Intergenic
1060833361 9:126734227-126734249 CTACCACAAATACAAACCTTGGG + Intergenic
1187329900 X:18328216-18328238 CTTCCACCAGTGCTATCCTTGGG + Intronic
1190228027 X:48560697-48560719 CTGCCACCTGTACCACCAATGGG + Exonic
1195038369 X:100991020-100991042 CCACTACCACTGCCACCCTTGGG - Intergenic
1198121430 X:133596235-133596257 CTCCCACCATTTCCAACCTTTGG - Intronic
1198697946 X:139363879-139363901 ATACCACCCATACCACCTTTGGG + Intergenic
1200376109 X:155782079-155782101 CTTCAACCAGGACCAGCCTTGGG - Exonic