ID: 974439185

View in Genome Browser
Species Human (GRCh38)
Location 4:61895069-61895091
Sequence GAGTCTTAAAATAAGTGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974439185_974439189 24 Left 974439185 4:61895069-61895091 CCTGCACACTTATTTTAAGACTC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 974439189 4:61895116-61895138 TCAAGCACTAACCTCCATGGAGG 0: 1
1: 0
2: 0
3: 6
4: 81
974439185_974439188 21 Left 974439185 4:61895069-61895091 CCTGCACACTTATTTTAAGACTC 0: 1
1: 0
2: 0
3: 10
4: 184
Right 974439188 4:61895113-61895135 AAGTCAAGCACTAACCTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974439185 Original CRISPR GAGTCTTAAAATAAGTGTGC AGG (reversed) Intronic
902306085 1:15540446-15540468 GAGTCTAAAAAAAAGTTAGCTGG - Intronic
902992477 1:20198268-20198290 CAGTCTTAAAATAATTATGAAGG - Intergenic
903196585 1:21693789-21693811 GGCTCTGAAAATAAGTGTGTTGG - Intronic
906169577 1:43713091-43713113 GAGTCATAAAATATTTATGCAGG + Intronic
906356646 1:45112277-45112299 GAATCTCAAAATAACTATGCTGG - Intronic
907340631 1:53733202-53733224 CACTGTAAAAATAAGTGTGCTGG + Intronic
908104629 1:60828646-60828668 CAGTTTTAAAATCAGTGTGGTGG - Intergenic
910380147 1:86618025-86618047 AAGTGTTAAAATAAGTGAGTTGG - Intergenic
910733856 1:90429714-90429736 GAGTCTCAAAATCATTATGCGGG - Intergenic
912377530 1:109223333-109223355 GAGTTTTAAGATAATTGGGCAGG + Intronic
913187011 1:116377916-116377938 GAGTTTTAAAATGAGTGAGTAGG - Intronic
913565931 1:120072172-120072194 CATTATTAAAATAAATGTGCAGG + Intergenic
913632202 1:120721381-120721403 CATTATTAAAATAAATGTGCAGG - Intergenic
914286516 1:146231536-146231558 CATTATTAAAATAAATGTGCAGG + Intergenic
914547547 1:148682278-148682300 CATTATTAAAATAAATGTGCAGG + Intergenic
914618965 1:149388075-149388097 CATTATTAAAATAAATGTGCAGG - Intergenic
917021597 1:170594282-170594304 AAGTCTTAAAATAAATCAGCAGG + Intergenic
918145292 1:181750868-181750890 GAGTCTTAAAATAAACATTCTGG + Intronic
918979050 1:191531130-191531152 CAGTATTAAAAGAAGTGGGCTGG + Intergenic
922054937 1:222032763-222032785 GAGTCAAAAAATAAGGGAGCTGG + Intergenic
1065282737 10:24156250-24156272 GAATCTCAAAATAATTATGCTGG - Intronic
1065546290 10:26825012-26825034 GAGTCCTAATATTTGTGTGCTGG + Intronic
1066023850 10:31331667-31331689 AAGTCTTAAAGTATGTGTGTGGG + Intronic
1068323751 10:55455874-55455896 GAGTGTTAAATTAAGTAAGCAGG + Intronic
1068561088 10:58514276-58514298 TATTCTTAAAATACGTGTACGGG + Intronic
1072325874 10:94298183-94298205 TAGTTTTAAAATGAGTGTGGTGG - Intronic
1078140668 11:8690412-8690434 TAGTCTTGAAATAAGTATTCTGG - Intronic
1080183269 11:29448842-29448864 GAAAATTAAAATATGTGTGCAGG + Intergenic
1081564829 11:44252247-44252269 GAGTCTTACTATGAGTGTGATGG + Intergenic
1082170006 11:48992384-48992406 AAGTCCTAAGATAAATGTGCAGG - Intergenic
1085170727 11:74447577-74447599 GAGTATTAAACCAAGTGTGGGGG - Intergenic
1086695819 11:89844243-89844265 AAGTCCTAAGATAAATGTGCAGG + Intergenic
1086710335 11:90000240-90000262 AAGTCCTAAGATAAATGTGCAGG - Intergenic
1087662361 11:101002457-101002479 AAGTCTTAAAATCAAAGTGCGGG + Intergenic
1087895478 11:103581055-103581077 GAGACATAAAATAATTTTGCTGG - Intergenic
1088182972 11:107133037-107133059 GAGTGAGAAAATAAGTGGGCAGG + Intergenic
1088519162 11:110676070-110676092 GAGTTGTGAAATAAATGTGCGGG - Intronic
1088970173 11:114767263-114767285 CAGCCCTAAAATAATTGTGCAGG - Intergenic
1094774167 12:33703565-33703587 GAATCTAAAAATAATTATGCTGG + Intergenic
1095332189 12:40979905-40979927 GAGTCTTAGAAGAATTGTTCTGG - Intronic
1095681598 12:44982977-44982999 GACTCTCAAAATAACTTTGCTGG - Intergenic
1097552590 12:61094169-61094191 GAATCTTAAAATAAGATTACTGG - Intergenic
1097602955 12:61717507-61717529 AAGTGTTAAAATAAATGTTCAGG - Intronic
1097649108 12:62274102-62274124 GAGTCTGAAAACTAGAGTGCGGG + Intronic
1097699919 12:62809349-62809371 TATCCTTAAAATAAGTGTACAGG - Intronic
1098077114 12:66743741-66743763 TAGTGTTAAAATTGGTGTGCCGG + Intronic
1098815394 12:75154674-75154696 GAGTCATGAAATATGTGAGCTGG + Intronic
1099409626 12:82308991-82309013 GAGTTTTAAAATAAGTATAATGG + Intronic
1100735228 12:97521684-97521706 GAATCTGAGAATAACTGTGCAGG + Intergenic
1102078201 12:110076572-110076594 GAGTCATAAAAGAAGTATCCTGG - Intergenic
1102933172 12:116877857-116877879 GAGACTCAAAACAAGTATGCTGG + Intronic
1108881846 13:55130290-55130312 GAGTCTCAAAATTATTTTGCTGG - Intergenic
1109476343 13:62884585-62884607 GAGTCTTAAAAAATGTGTTTAGG - Intergenic
1110597732 13:77337679-77337701 GAGTCTTCAGATAATGGTGCTGG - Intergenic
1113295743 13:108956786-108956808 GAGTCTAGGTATAAGTGTGCAGG - Intronic
1114325370 14:21583505-21583527 GAGTCTTAAAAAAGATGTGTCGG - Intergenic
1115022104 14:28694383-28694405 GGGCCTTGAAATAAGTGTGAAGG - Intergenic
1120327803 14:83052060-83052082 GAGTATTAAAATATGTGTCCAGG - Intergenic
1121167628 14:91822352-91822374 GAATCTCAAAATAATTATGCTGG + Intronic
1125752587 15:42038707-42038729 GAGGCTTGAAAGCAGTGTGCGGG + Intronic
1125842076 15:42812355-42812377 GAGTTTTAAAAAAATTGTCCTGG + Intronic
1126546848 15:49883361-49883383 GAGTCTTCAAATCTGAGTGCCGG - Intronic
1130519011 15:84648021-84648043 GAGTCCCAAGCTAAGTGTGCTGG - Intronic
1134885741 16:17789794-17789816 GAGTCTCAAAATAACCCTGCTGG - Intergenic
1136985266 16:35097692-35097714 GAGGCTTAACTTAAATGTGCAGG + Intergenic
1137243145 16:46676377-46676399 GAGGCTTAACTTAAATGTGCAGG - Intronic
1137353115 16:47731863-47731885 GATGCTTAAAATTAGAGTGCAGG - Intergenic
1138013244 16:53404108-53404130 GAATCTGAAAATAATTATGCTGG + Intergenic
1139989779 16:70930654-70930676 GACTCTTGAACTATGTGTGCGGG + Intronic
1140808746 16:78557016-78557038 GTGTTTTAAAGTAAGTTTGCCGG - Intronic
1143246412 17:5489700-5489722 GAGTCTTCTAATAAGTGGGAAGG + Exonic
1143417989 17:6764025-6764047 TAGCCTTCAAATAAGTGTGTAGG - Intronic
1145837063 17:27962421-27962443 GAGTTCTAAAATAAGCATGCAGG - Intergenic
1146138374 17:30343137-30343159 AAGTCTTAAAATAATTGTCTTGG - Intergenic
1146579723 17:34026139-34026161 GAGTCTTGCAATAAGTTTGCTGG + Intronic
1147345545 17:39790753-39790775 GAGATTTAAAATAAGTAGGCTGG + Intronic
1151057022 17:71044179-71044201 CAATCTTAAAATGAGTGTGTAGG + Intergenic
1151091865 17:71449454-71449476 GAGACTTAAAATAAATTTGTGGG + Intergenic
1156875171 18:42001800-42001822 CAGTCTTAATAGAAATGTGCGGG - Intronic
1158411343 18:57208633-57208655 GAATCTCAAAATAAGAGTCCAGG + Intergenic
1159371132 18:67528849-67528871 GTGGCTTAACATATGTGTGCTGG - Intergenic
1163336255 19:16674081-16674103 GTCTCTTAAAAAAAGTGTCCAGG + Intronic
1168156580 19:54476602-54476624 GAGCATTAAAAGAAGTGTGGTGG - Intergenic
926621863 2:15053810-15053832 GTGTCTTGAGGTAAGTGTGCAGG - Intergenic
928878725 2:36072459-36072481 GTATCTTAAATTAAGTCTGCTGG - Intergenic
929394255 2:41504182-41504204 AAATCTTAAAATAATTTTGCTGG - Intergenic
930507020 2:52295602-52295624 GAGATTTAAAATAAGTTTCCAGG + Intergenic
931548732 2:63418594-63418616 GAGTCTTAAAATACATGTTGGGG + Intronic
935302548 2:101705393-101705415 GTGTCTGAACACAAGTGTGCTGG - Intronic
936251535 2:110871853-110871875 GAGTCTCAGAATGAGTGGGCAGG - Intronic
937632224 2:124115928-124115950 GACTCTTAAAATAAGCATGGTGG - Intronic
939358699 2:141140048-141140070 GAATCTCAAAATAACTATGCTGG + Intronic
939521308 2:143234224-143234246 GAGTCTTAAAAAATGCCTGCAGG - Intronic
940620562 2:156107837-156107859 GACTTTCAAAATAAGTATGCTGG + Intergenic
941352771 2:164456543-164456565 GAGTCTTAAAATAAAAGTACTGG + Intergenic
942790102 2:179751533-179751555 AACTCTTAAAATATGTGTGTAGG - Intronic
944974275 2:205030117-205030139 GAGTCTTAAAATCAGTTTAAAGG - Intronic
946101303 2:217326789-217326811 GGAACTTAAAATAAGTGTTCTGG + Intronic
947321673 2:228926153-228926175 AAGTCTTGAAATAAGTGTGAAGG - Intronic
1168998797 20:2151604-2151626 GTTTCTTTAAATAAGGGTGCCGG - Intronic
1169218792 20:3808709-3808731 GAATCTCAAAATCATTGTGCTGG - Intergenic
1170401514 20:15989779-15989801 GAGTCTTAAAATAAAAGAGAAGG - Intronic
1181391159 22:22582033-22582055 AAGTCTTAAGATCAATGTGCTGG + Intergenic
1183158817 22:36096599-36096621 GAATCTTAAAAACAGTGTGCTGG - Intergenic
1184636601 22:45837068-45837090 GAGTTTTAAAATATATGTCCTGG + Intronic
950472836 3:13197242-13197264 GATTTTTAAAAAATGTGTGCAGG - Intergenic
951520158 3:23603796-23603818 GACTATTAAAATAAGTGTTTTGG - Intergenic
952709107 3:36411541-36411563 GACTCTTAAAAGAAGTGCTCAGG + Intronic
953938199 3:47065472-47065494 GAATCTCTAAGTAAGTGTGCTGG + Intronic
954169975 3:48793567-48793589 GAGTCTTAAAAAAAAAATGCTGG - Intronic
955105128 3:55890778-55890800 GAGTTTTAAAATAAGTTCCCAGG + Intronic
959348689 3:105232672-105232694 GAGTCTGAACATAAGTTTTCTGG + Intergenic
959911909 3:111772830-111772852 GCCTGTTAAAAAAAGTGTGCAGG - Intronic
962618164 3:137149373-137149395 GAAGCTTAGAATAAGGGTGCAGG - Intergenic
962719364 3:138158589-138158611 GAGAATAAAAATAAGTGGGCCGG + Intergenic
963225200 3:142855334-142855356 TAATCTTAAAATAATAGTGCAGG + Intronic
963662742 3:148148373-148148395 GAGTGGTAAGATAACTGTGCTGG - Intergenic
963681199 3:148379533-148379555 GAGTCTTCAAATAATTGTTAAGG - Intergenic
964086626 3:152826840-152826862 AAGTCATAAACTGAGTGTGCAGG - Intergenic
967511210 3:190314874-190314896 GAATCTTGAGATAAGTGTGTGGG - Intronic
970872620 4:20833786-20833808 GAGTCTAAAATTCAGTCTGCAGG - Intronic
971147235 4:23991638-23991660 AACTCTTAAAATTAGTTTGCAGG - Intergenic
971764863 4:30817848-30817870 GTGTTTTAAAAGAAGTGTTCTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
972262358 4:37422361-37422383 GAGCTTTAAAATAATTATGCTGG - Intronic
974147017 4:57961624-57961646 GAATGGTAAAATAAGTGTCCTGG + Intergenic
974439185 4:61895069-61895091 GAGTCTTAAAATAAGTGTGCAGG - Intronic
979767549 4:124480485-124480507 CGGTTTTAAAATAACTGTGCAGG + Intergenic
981039300 4:140208417-140208439 GATTCTTAAAACTACTGTGCTGG - Intergenic
981644090 4:146978687-146978709 GAGACTTAAAATAAATCTACTGG + Intergenic
981754459 4:148126398-148126420 AAGTCTTAAAATAAGTTTTCAGG + Intronic
982446997 4:155503737-155503759 GAGTCTTAAAATAAACGTTTTGG + Intergenic
982682509 4:158448700-158448722 GAGTGTTAAAAAATGTGTACAGG + Intronic
984157681 4:176211502-176211524 GAGTCTTTTAATAAGGGTGAGGG - Intergenic
984461012 4:180036529-180036551 GTCTCTGGAAATAAGTGTGCTGG + Intergenic
985901975 5:2803563-2803585 GTGCCTTCAAATAAATGTGCTGG - Intergenic
986841245 5:11700003-11700025 GGGTTTTAAAATATGTGTGTGGG + Intronic
990270309 5:54130320-54130342 GAGATTTAAAAAAAGTGTTCTGG + Intronic
990456114 5:55989778-55989800 CAGTCTTAAAATAAGGGTAGGGG + Intronic
993134548 5:83942033-83942055 GAGTTTTAAATTAAGTGTATTGG - Exonic
995065687 5:107859294-107859316 GAGGCTTAAAATAATTTTTCTGG - Exonic
995248186 5:109959580-109959602 AAGAATTAAAATAATTGTGCTGG + Intergenic
995254327 5:110029084-110029106 GAGTCTAAAAGTAGGTGTACAGG + Intergenic
995685730 5:114770131-114770153 GTGTCTTCAATAAAGTGTGCTGG - Intergenic
996298482 5:121953498-121953520 GAATTTTAAAATAATTATGCTGG - Intergenic
996438926 5:123467420-123467442 GAGGCTTAAAAAAATTGTGGTGG - Intergenic
996682383 5:126242076-126242098 AGGTCTGAAAATTAGTGTGCAGG + Intergenic
996856852 5:128017818-128017840 AAGTCTTAAAATATTTGAGCAGG - Intergenic
997768494 5:136529165-136529187 CAGTCTTAAAATGACTATGCTGG + Intergenic
1002037004 5:176479369-176479391 GACTCTAAAAATAAAAGTGCAGG + Intronic
1007811389 6:44488552-44488574 GAGTTTTAAAATAAGTGTCAAGG - Intergenic
1008623058 6:53290812-53290834 GAATCTTAAAATTAGTGTTCAGG - Intronic
1010111219 6:72235719-72235741 GGGTCTGAAAGTAAGTATGCTGG + Exonic
1010874976 6:81091417-81091439 GAATCTTAAAACAAGTATGCTGG - Intergenic
1012819211 6:104063527-104063549 GAATCTTAAAATAATTATGTGGG + Intergenic
1012840359 6:104321887-104321909 CAGTCTTAAGATAAGTTTACTGG - Intergenic
1014121600 6:117731861-117731883 GAGTTTTAAAATATTTGTTCAGG + Intergenic
1015399002 6:132767860-132767882 AAGTATTAAGATAAGTGGGCCGG - Intergenic
1016938593 6:149466566-149466588 AAGTTTTAAAATAATTGTGGTGG - Intronic
1018280962 6:162184952-162184974 TAATCTTAAAATAAGGGTGGGGG + Intronic
1020714239 7:11649644-11649666 AAGACTTAAAATAAGTGAGGAGG + Intronic
1020843505 7:13253402-13253424 GAATCTCAAAATAATTATGCTGG + Intergenic
1027567743 7:79818215-79818237 AAATCTTAAATTAAGTGTGAAGG + Intergenic
1027890950 7:83974142-83974164 AAATCTTAATATATGTGTGCTGG - Intronic
1028475766 7:91251450-91251472 GATTCCTAAAATCAATGTGCTGG + Intergenic
1028552579 7:92086479-92086501 GAGTCTTAATTTAAGTATGAAGG + Intronic
1030292548 7:107887261-107887283 AAGAATTAAAATAAGTGGGCTGG + Intergenic
1030787610 7:113681932-113681954 GAGTCTTAAATAAATTGTTCAGG - Intergenic
1032997182 7:137460168-137460190 GATTATTACAATAAGTGTTCAGG + Intronic
1033045183 7:137955466-137955488 GAGTCTAGAAATATGTGTGAGGG + Intronic
1033061706 7:138115851-138115873 GAGTAGCAAAATAAGTTTGCTGG - Intronic
1033468108 7:141615746-141615768 GACTCTTATAATAAGTCTCCAGG + Intronic
1033651184 7:143345372-143345394 GATTCTTAAAATGAGTTTCCAGG + Intronic
1035406686 7:158603306-158603328 GAATCTTAACAGTAGTGTGCTGG + Intergenic
1037612168 8:20485227-20485249 GGCTCTTTAAATATGTGTGCAGG - Intergenic
1038559817 8:28564050-28564072 GAATCTGAAAATAAGGGTGTGGG - Exonic
1039479468 8:37861574-37861596 GAGTCTTAAAAAAATTGCCCAGG + Exonic
1040516780 8:48142304-48142326 GAGGCAGAAAATAAATGTGCAGG + Intergenic
1041016937 8:53600439-53600461 AAGTCTTCAAATAATGGTGCTGG - Intergenic
1042145939 8:65730478-65730500 GATTCTTATAAGAAGTGTGCTGG - Intronic
1042890670 8:73606931-73606953 GAATCTCAAAATAATTATGCTGG + Intronic
1042985380 8:74577171-74577193 GAGGCTTAAAGAAGGTGTGCGGG + Intergenic
1044587377 8:93880485-93880507 GAGTCATAAAAGAAATATGCAGG - Intronic
1044670817 8:94679039-94679061 GAGGCTTATAATAAGTGTCTTGG + Intronic
1045154621 8:99453648-99453670 GGTTTTTAAAATAAGTGTGGTGG - Intronic
1047667978 8:127113305-127113327 GACACTTGAAATAAGTCTGCTGG - Intergenic
1049143533 8:140980247-140980269 AAGTTTTAAAATCAGAGTGCAGG + Intronic
1050431438 9:5566126-5566148 GAGTCACAAAATGAGAGTGCGGG - Intronic
1050962964 9:11760434-11760456 GAGTTTTAAAATAACAGTGGAGG + Intergenic
1052651333 9:31306552-31306574 GAATCTTAATAGAAGTGTGTGGG - Intergenic
1058856900 9:109071183-109071205 GACTCTCAAAATAAGTATGTTGG - Intronic
1059952768 9:119483910-119483932 GAGCATTAAACCAAGTGTGCGGG - Intergenic
1062127619 9:134872070-134872092 GACCCTTAAAATAGGTCTGCCGG - Intergenic
1186995256 X:15114626-15114648 CAGTTTTAAAATATGTATGCAGG - Intergenic
1194949064 X:100103356-100103378 TGGTCTTAAAATAACTGTGAAGG - Intergenic