ID: 974447191

View in Genome Browser
Species Human (GRCh38)
Location 4:62000392-62000414
Sequence ATGTATTTCTTTAGGTAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974447191 Original CRISPR ATGTATTTCTTTAGGTAATG TGG Intronic
902305188 1:15532108-15532130 AGTTATTTCTTTTGCTAATGTGG - Intronic
902616319 1:17625413-17625435 ATGTAATATTTCAGGTAATGGGG + Intronic
904524758 1:31124640-31124662 TTGTATTTTTTTAAGAAATGGGG + Intergenic
905086664 1:35385776-35385798 ATGAAATTCTTTTGGTAAGGGGG - Intronic
906455359 1:45991899-45991921 ATGTATTTTTTTTAGAAATGGGG + Intronic
906899302 1:49816057-49816079 ATGTATTTTTTTAAGAGATGGGG + Intronic
906941310 1:50257907-50257929 ATATTTTTCTATAGGTATTGGGG + Intergenic
908971503 1:69839649-69839671 ATGTATATATTTAGGTGAAGGGG - Intronic
909007962 1:70299350-70299372 ATTTCACTCTTTAGGTAATGGGG + Intronic
909534565 1:76721861-76721883 CTGTATTTCTTTAAATATTGTGG - Intergenic
909786998 1:79625910-79625932 ATTTAGTTCATTATGTAATGTGG + Intergenic
910535252 1:88290230-88290252 CTGTATTTCTGTGGGGAATGAGG + Intergenic
910907817 1:92200161-92200183 TTGTACTTCTTTATGTCATGGGG + Intergenic
911517358 1:98882715-98882737 ATGTATTTGTTTAAGAAATAGGG + Intergenic
915030466 1:152876116-152876138 ATGTATTTATTTACTAAATGTGG + Intergenic
915149545 1:153819232-153819254 ATGTATATCTAGAGGAAATGTGG - Intronic
916155625 1:161843848-161843870 AAGAATTTCTTTTGCTAATGAGG + Intronic
917128316 1:171712804-171712826 ATGTACTGTTTTAGGTACTGAGG + Intronic
918617916 1:186568981-186569003 ATCTATTTGTTCAGCTAATGGGG + Intergenic
918735814 1:188061853-188061875 CAGAATTTCTTTAGTTAATGAGG + Intergenic
919083050 1:192889403-192889425 ATTTAATCCTTTGGGTAATGAGG - Intergenic
919165215 1:193884267-193884289 ACCTTTTCCTTTAGGTAATGAGG + Intergenic
919304230 1:195809190-195809212 ATGTATCACTTTAAATAATGAGG + Intergenic
919671745 1:200344644-200344666 ATGTAAATCTTGATGTAATGAGG + Intergenic
919675994 1:200383985-200384007 ATGTATTCATTTAGGTTTTGGGG - Intergenic
919957945 1:202438275-202438297 ATTTTTTGCTTTAGGTAAGGGGG - Intronic
922315358 1:224436778-224436800 ATTTTATTCTGTAGGTAATGTGG - Intronic
922395243 1:225192932-225192954 ATGTTTTTATTTAACTAATGTGG + Intronic
923768640 1:236917072-236917094 ATGTATTTGTTTATGTTCTGTGG + Intergenic
924496277 1:244593312-244593334 ATGACTTTGTTTAGGTAAGGAGG - Intronic
924816309 1:247445046-247445068 TTGTGTTTCTTTGGGGAATGTGG - Intronic
1063462711 10:6224657-6224679 ATTCATTTTTTTAGATAATGGGG + Intronic
1063880909 10:10531122-10531144 ATGTATTTCTTTCGAAGATGTGG - Intergenic
1064256969 10:13750630-13750652 ATGGATTTCTTCAGTTCATGTGG - Intronic
1066472396 10:35711873-35711895 ATGAATTTCTTTAGTTATTCAGG - Intergenic
1067695386 10:48531403-48531425 ATGTATTTCAATAGGTTTTGGGG - Intronic
1068097309 10:52507957-52507979 ATATAATCCTTTAAGTAATGAGG - Intergenic
1068290758 10:54999443-54999465 ATCTTTTCCTTTAGGTAATGAGG + Intronic
1068462591 10:57346999-57347021 ATGTATTGCTTTGGGTAGTATGG + Intergenic
1068962073 10:62877064-62877086 ATTTATTGCTTGAGGTATTGAGG + Intronic
1069278886 10:66628381-66628403 AATTATTGCTTTAGGTTATGGGG + Intronic
1070582307 10:77731441-77731463 ATTTACTTCTTTTGGTAATGGGG - Intergenic
1070903725 10:80053342-80053364 ATGTCTTTTTATAGATAATGTGG - Intergenic
1070986485 10:80694081-80694103 ATGTATTCCTTTTAGAAATGGGG - Intergenic
1072674875 10:97458319-97458341 AAAGATTTCTTTTGGTAATGGGG - Exonic
1072768108 10:98112429-98112451 AAGTATTTATTTAGGAACTGAGG + Intergenic
1072834390 10:98695592-98695614 ATGTACTTCTCTAGGCAATAGGG - Intronic
1074734579 10:116416119-116416141 ATATATTGGTTTATGTAATGAGG + Intergenic
1074958366 10:118415110-118415132 TTGTTTTTCTTAAGATAATGTGG - Intergenic
1076285019 10:129286867-129286889 AAATATTTATTTGGGTAATGTGG - Intergenic
1076391161 10:130103486-130103508 ATGTATTTATTTACTTATTGAGG - Intergenic
1077379692 11:2224616-2224638 ATATTTCTCTCTAGGTAATGCGG - Intergenic
1078272108 11:9805487-9805509 GGGTAATTCTTTAGGAAATGTGG + Intronic
1078737530 11:14034165-14034187 ATGTATTACTTTAGATGAAGAGG - Intronic
1079890441 11:26045923-26045945 ATGTATTTCCTGGGGTAGTGGGG + Intergenic
1080632641 11:34093200-34093222 ATATATTTTTTTAAGAAATGGGG + Intronic
1081082146 11:38755693-38755715 ATCTTTTCCTTTAGGTAATTAGG - Intergenic
1081171752 11:39878146-39878168 ATAAATTACTTTAGGTAATGTGG - Intergenic
1081245277 11:40758434-40758456 ATCTATTTCTTCAGTCAATGAGG - Intronic
1081290273 11:41316418-41316440 ATGTAATGCTTTAGTCAATGAGG - Intronic
1083963007 11:66024965-66024987 ATGTACCTCTTTAGGCCATGAGG - Intronic
1084622807 11:70285009-70285031 ATGTATTTCTTTATTTAAGATGG + Intronic
1085379557 11:76102156-76102178 ATAAATTGCTTTAGGCAATGTGG + Intronic
1085703903 11:78769017-78769039 CTGCATGTCTTTAGGAAATGTGG - Intronic
1086595922 11:88570356-88570378 ATGTATTTTTATACTTAATGAGG - Intronic
1086836354 11:91628483-91628505 ATATATTTCTTTAGAAAATGGGG - Intergenic
1087726693 11:101726136-101726158 ATCAATTTCTTTAGGTTATTAGG - Intronic
1089766244 11:120768127-120768149 ATGTATTGCTTTGGGTAGTATGG + Intronic
1090900269 11:131024768-131024790 AGGTAATTTTATAGGTAATGAGG - Intergenic
1091346140 11:134855480-134855502 ATGGATTTCTTTTGGTAAAAAGG + Intergenic
1094433251 12:30393624-30393646 ATGTTTTCCTTTAGGTAATGAGG + Intergenic
1094436598 12:30427002-30427024 ATCTTTTCCTTTGGGTAATGAGG + Intergenic
1095129435 12:38521570-38521592 AAATATTTGTTTAGGAAATGAGG - Intergenic
1095301737 12:40592343-40592365 ATATATGACTTTAGGTATTGTGG + Intergenic
1095794709 12:46205723-46205745 ATGTATTTATCTAAATAATGAGG + Intronic
1095874907 12:47069439-47069461 ATCTAAATCTTTAGATAATGTGG + Intergenic
1096436846 12:51598895-51598917 ATGTATTTCTTAAGGAAAAGGGG - Intronic
1097982737 12:65751229-65751251 ATTTATTTATTTAGGAGATGGGG + Intergenic
1099210294 12:79778063-79778085 AATTATTTCTATAGGTAATATGG + Intronic
1099545393 12:83973389-83973411 AATTATTTCTATAGGTAATTGGG - Intergenic
1100865159 12:98849928-98849950 ATGTATGTCTTTGGTTAATTTGG + Intronic
1101370629 12:104126236-104126258 TTTTATTTCTTTAGATACTGAGG - Exonic
1101990572 12:109480900-109480922 ACATTTTTCTTTAGGTAATTGGG + Intronic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103433622 12:120907664-120907686 AAGTGTTTCTTGAGGAAATGTGG + Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105436462 13:20382795-20382817 ATGTATAGCTTTTGGTAATATGG + Intergenic
1105500323 13:20966142-20966164 ATGTACTTCCTTAGCTACTGAGG - Intergenic
1106387109 13:29298298-29298320 ATGTTTTTCCTTAGGTAGAGAGG - Intronic
1108561455 13:51648186-51648208 CAGTATTTCTTTAGGAAATAAGG + Intronic
1108945983 13:56024469-56024491 ATGTGTTTCTTTAAGTAAATGGG + Intergenic
1109493417 13:63133440-63133462 AAGTATTGCTTTAAGTAAAGAGG - Intergenic
1110108775 13:71716041-71716063 ATGTAATGCAATAGGTAATGAGG - Intronic
1110399823 13:75076922-75076944 AAGAATTTCTTAAGGAAATGTGG - Intergenic
1110962795 13:81651159-81651181 ATATATTTGTTTAAGTAAAGTGG + Intergenic
1111190750 13:84803474-84803496 ATGTATATCTATAGGCATTGAGG + Intergenic
1111400511 13:87728202-87728224 ATGTATTTCCTTTGGTGATATGG - Intergenic
1111456556 13:88492137-88492159 ATATTTTCCTTTAGTTAATGAGG + Intergenic
1111456839 13:88495655-88495677 ATATATTTCTGTGGGTAATTAGG - Intergenic
1111739564 13:92186819-92186841 AAGTAAATTTTTAGGTAATGTGG - Intronic
1112227933 13:97558662-97558684 TTTTATTTCTTTAGGTTTTGGGG + Intergenic
1113006756 13:105713485-105713507 ATAAATTTCTTTGGGTGATGTGG + Intergenic
1113083643 13:106544820-106544842 ATATTTTTCTTCAGGTAATTGGG - Intronic
1113961926 13:114131034-114131056 AGGGATTTCTTTTGTTAATGTGG - Intronic
1114035179 14:18618235-18618257 ATATATATGTTTAGGTTATGAGG + Intergenic
1114123466 14:19696780-19696802 ATATATATGTTTAGGTTATGAGG - Intergenic
1114154053 14:20079303-20079325 GTGTATTTCTTTGGGCAGTGTGG - Intergenic
1114248752 14:20938917-20938939 ACTTATTACTTTAGGTAGTGTGG - Intergenic
1114292195 14:21297448-21297470 ATTTCTTTCTTTAGAAAATGGGG + Intronic
1114489289 14:23087688-23087710 TTTTAGTTCTATAGGTAATGGGG - Intronic
1114586751 14:23821986-23822008 ATACATTGCTTTAGGTAATATGG + Intergenic
1114861297 14:26526805-26526827 ATCTACTTCTTAAGGCAATGTGG + Intronic
1114952389 14:27771546-27771568 ATATATTTCTATAGGTTATTGGG - Intergenic
1115451326 14:33551324-33551346 AGGTATTTCTTTAGGTAAGGAGG - Intronic
1115970752 14:38942328-38942350 ATGTATTTATTTAGATTGTGTGG - Intergenic
1116011906 14:39361221-39361243 ATAGATTGCTTTAGGTAATATGG + Intronic
1116402034 14:44519425-44519447 GTGTATCTCTATAGGTAAAGTGG + Intergenic
1116438349 14:44920753-44920775 ATGTATTTGTTGAGGAAATTAGG - Intergenic
1116581377 14:46646495-46646517 ATTCATTTCATTAGGTATTGGGG - Intergenic
1117461612 14:55950947-55950969 TTGTATTTCTTTGAGTAGTGAGG - Intergenic
1117476956 14:56105176-56105198 ATTTCTTTATCTAGGTAATGAGG + Intergenic
1117931984 14:60853120-60853142 ATGAATTTCTTTGGGCAATATGG + Intronic
1118683056 14:68262988-68263010 ATGCTTTTCTCTTGGTAATGTGG + Intronic
1119196360 14:72719540-72719562 AAGTATTTATTTATGTACTGTGG - Intronic
1119275891 14:73355388-73355410 ATGAATTTCTCTATATAATGTGG - Intronic
1120394290 14:83948467-83948489 ATAGATTACTTTAGGTAGTGTGG + Intergenic
1120804702 14:88734488-88734510 ATGTATCTCTTTTTGTATTGTGG - Intronic
1121423553 14:93832462-93832484 AGGTACTTCTTTAGGTACTGGGG + Intergenic
1123421203 15:20138766-20138788 ATTTATTTATTTATTTAATGAGG + Intergenic
1123530428 15:21145306-21145328 ATTTATTTATTTATTTAATGAGG + Intergenic
1123799582 15:23806066-23806088 ATGTATTTCCATAGGTTATTGGG + Intergenic
1123845778 15:24300614-24300636 ATTTATTTATTTATTTAATGGGG - Intergenic
1123864812 15:24508323-24508345 ATTTATTTATTTATTTAATGGGG - Intergenic
1124213576 15:27785089-27785111 GTGTTTTTCTGTATGTAATGTGG - Intronic
1125035136 15:35114918-35114940 ACGTATTTCATTAGATAAAGAGG + Intergenic
1125190242 15:36983719-36983741 ATGGATTGCTTTAGGTAGTATGG + Intronic
1125985435 15:44046759-44046781 ATGTATTACATTATGTATTGTGG - Intronic
1126808021 15:52372670-52372692 TTGTTTTTCTTTTGGTAATCTGG - Intronic
1127625724 15:60778408-60778430 ATGCATTACCTTAGGTTATGTGG + Intronic
1128377474 15:67087724-67087746 ATGCATTTCTTAAGGTGGTGGGG + Intronic
1137253144 16:46754634-46754656 ATGTGTTTCTTTAGTTATGGAGG - Intronic
1137330234 16:47487233-47487255 ATATATTGCTTCAGGCAATGAGG + Intronic
1137388502 16:48061666-48061688 CTGTATTTCTTTATGTTATATGG + Intergenic
1139067376 16:63334665-63334687 ATGTATTTCTTTTGGCATAGGGG - Intergenic
1139293919 16:65883264-65883286 ATGTAGTTCTTTATGTATTCTGG - Intergenic
1139717638 16:68826194-68826216 ATGTATTTTTTTAGACACTGGGG + Intronic
1140853470 16:78956126-78956148 ATGTATTTGTTTAGGTTTTGGGG + Intronic
1143278651 17:5733431-5733453 AAATATTTCTTTGAGTAATGTGG - Intergenic
1144959420 17:19036546-19036568 AAGTATTTTTTTAAGGAATGGGG - Intronic
1144975739 17:19137978-19138000 AAGTATTTTTTTAAGGAATGGGG + Intronic
1146221159 17:31022492-31022514 ATGTTTTTATTTAGGTGATTGGG + Intergenic
1147045608 17:37749662-37749684 ATTTATTTATTTAGAGAATGGGG - Intergenic
1149203701 17:54218156-54218178 AAGTATTTCTTTGGGTTATCTGG + Intergenic
1149638055 17:58185929-58185951 AGGTATTGTGTTAGGTAATGAGG + Intergenic
1149790721 17:59474636-59474658 TTGTATTTCTTGAGGAGATGGGG + Intergenic
1152775809 17:82201339-82201361 ATGTGTTTGTTGAGTTAATGTGG - Intronic
1153191629 18:2547157-2547179 TTGTATGTCTTTTTGTAATGGGG - Intronic
1153306442 18:3635979-3636001 ATTTCATTCTTTAGGAAATGAGG - Intronic
1154407424 18:14107093-14107115 TTGTATCTCAGTAGGTAATGTGG - Intronic
1155797260 18:30055505-30055527 ATTTAATTCTTTAGGTCATTAGG - Intergenic
1156009377 18:32478738-32478760 ATGTATTTATCTACTTAATGTGG + Intergenic
1156146680 18:34189765-34189787 ATGTATTTATTTTGCAAATGAGG - Intronic
1156569242 18:38233864-38233886 ATGTAATGCTTTAAGTAAGGAGG + Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1157887861 18:51385630-51385652 ATGTATTTATCTGGGTAATTTGG + Intergenic
1158608685 18:58919180-58919202 ATTTACTTCTTTTGGTAACGGGG - Exonic
1159066848 18:63579011-63579033 AGATATTGCTTTAGGTACTGAGG - Intergenic
1159279279 18:66264485-66264507 ATGTATTTCCTTAAGAATTGTGG + Intergenic
1159570700 18:70109288-70109310 ATTTATTTCTTTTGAAAATGAGG + Intronic
1159832288 18:73292239-73292261 ATGTATTTTTTTAGGAACAGAGG + Intergenic
1159907993 18:74115663-74115685 ATGTATTTCTTTAGAAAGTATGG - Intronic
1164487619 19:28673310-28673332 TTTTATTTCTTTAAGTAATGTGG - Intergenic
1166524304 19:43501621-43501643 ATGTCTTCCTTTGGGGAATGGGG + Intronic
1167387236 19:49171179-49171201 ATGTATTTATTTTAGAAATGGGG - Intronic
1168374281 19:55862778-55862800 ATGTATTTCTTTTTGTGTTGGGG + Intronic
927456645 2:23257170-23257192 TTGTTTTTATTTAGTTAATGTGG - Intergenic
928034379 2:27808062-27808084 ATGTATTTCTATCTGGAATGAGG + Intronic
928737203 2:34306104-34306126 ATGTGTTGCTTTAGTAAATGGGG - Intergenic
928792609 2:34975987-34976009 ATGTTTTTCTGCAGTTAATGTGG + Intergenic
928975973 2:37086923-37086945 ATGTATTAGTCTATGTAATGGGG + Intronic
929189584 2:39126729-39126751 ATTTATTTCTTTAAAAAATGTGG + Intergenic
930842839 2:55866603-55866625 ATATATTTCTTTAGAAAATGGGG - Exonic
931095941 2:58941301-58941323 ATGTATTACTTAAGTTAATTTGG + Intergenic
931662114 2:64575225-64575247 ATGTTTTTCATTAGGTCATCTGG - Intronic
931749579 2:65318670-65318692 ATGTATTTATTTATGTATTTGGG + Intronic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
933485227 2:82913221-82913243 ATGTATTGCTTTGGGTAGTATGG - Intergenic
933512030 2:83252683-83252705 ATAGATTGCTTTGGGTAATGAGG - Intergenic
935507094 2:103919149-103919171 ATTTTGTTCTTTATGTAATGGGG - Intergenic
935793833 2:106620037-106620059 ATGTCTTTGTTTTGGTAATAGGG + Intergenic
936750057 2:115631241-115631263 TTGTATTTCTTTAGGGTCTGTGG + Intronic
937566776 2:123302076-123302098 CTGTATTTATTGAGGTAATCAGG - Intergenic
938276068 2:130024632-130024654 ATGTATATGTTTAGGTTATGAGG - Intergenic
938327028 2:130415388-130415410 ATGTATATGTTTAGGTTATGAGG - Intergenic
938362913 2:130706088-130706110 ATGTATATGTTTGGGTTATGAGG + Intergenic
938879568 2:135571088-135571110 ACATATTTTTTTAGTTAATGAGG + Intronic
939119256 2:138096874-138096896 ATGTTTTTCAGTAGGTAAAGGGG + Intergenic
939386810 2:141511022-141511044 CTGTCTTTCTTAAGGTAATAAGG + Intronic
939521514 2:143237061-143237083 ATTTCATTCTGTAGGTAATGTGG + Intronic
939663746 2:144923597-144923619 ATGTATTTTTTTAAATAATAAGG - Intergenic
939770734 2:146313301-146313323 ATGTATTTCTTTACATGAAGAGG - Intergenic
939781381 2:146452860-146452882 TTGTAGATCTATAGGTAATGGGG + Intergenic
940166213 2:150775792-150775814 AGGTATTTCTTTTGGCAATGAGG + Intergenic
940785669 2:157979002-157979024 ATGTTTTTCTTTTTTTAATGTGG + Intronic
940786774 2:157989720-157989742 ATGTCTTCCTTTGGGTAATTAGG + Intronic
940786788 2:157989864-157989886 AGGTATGTCTTTGGGAAATGTGG + Intronic
941198750 2:162483057-162483079 TTTTATTTCTTTAGCTTATGAGG - Intronic
941264718 2:163347350-163347372 ATGTATTTCTTTATGTACTTGGG - Intergenic
941351203 2:164439130-164439152 ATATATTTCTTGAGGTCATCAGG - Intergenic
941446392 2:165605431-165605453 ATGTATTTCTCTAAGAGATGAGG - Intronic
942395094 2:175538614-175538636 ATCTGTGTCTTTAAGTAATGAGG - Intergenic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
943910662 2:193562708-193562730 ATGTATTTATTTAATTATTGTGG + Intergenic
944321736 2:198352918-198352940 AAATATTTTTTTATGTAATGTGG - Intronic
944399208 2:199305830-199305852 TTAAATTTCTTTAGGTAATTAGG - Intronic
945021123 2:205572737-205572759 ATTTATTTATTTAGGAGATGGGG - Intronic
945172980 2:207016093-207016115 AGGAAATTCTTTAGTTAATGGGG + Intergenic
945494071 2:210488723-210488745 ATGTTTTTCTTTGGGAATTGTGG + Intronic
945526661 2:210896372-210896394 CAGTAGTTCTTTAGGTACTGTGG - Intergenic
945754098 2:213824810-213824832 ATAGATTTCTTTGGGTAATATGG + Intronic
946469406 2:219944171-219944193 CTGTATTTATTTAGATAATCAGG + Intergenic
947044589 2:225967086-225967108 GTGGATTTCTGAAGGTAATGCGG - Intergenic
949011587 2:241682613-241682635 TTGTATTTTTTGAGGAAATGTGG - Intronic
1171285366 20:23933058-23933080 ATCTTTCCCTTTAGGTAATGAGG - Intergenic
1171378922 20:24718069-24718091 TTGTTTTTCTTCAGGTAATTTGG + Intergenic
1173327384 20:42046400-42046422 ATGCATTTCTTGAGTGAATGGGG + Intergenic
1173480473 20:43394853-43394875 AGGTATTTCTTTAGGCCTTGGGG + Intergenic
1174062270 20:47841098-47841120 ATGCATATCTTGTGGTAATGGGG + Intergenic
1174144469 20:48441615-48441637 ATGTATGTCTTTATATAATGTGG + Intergenic
1174681094 20:52409205-52409227 ATGTAGTTCTTTAGGTGAGAGGG + Intergenic
1174848522 20:53968029-53968051 ATTTATTTATTTAAGAAATGAGG + Intronic
1176362606 21:6010632-6010654 ATTTATTTAATAAGGTAATGGGG + Intergenic
1176900116 21:14430876-14430898 CTATAGTTCTTTGGGTAATGTGG - Intergenic
1177082073 21:16652114-16652136 ATGTTTTTCTGTAGGGAAAGCGG + Intergenic
1177090567 21:16762342-16762364 GTAGATTACTTTAGGTAATGTGG - Intergenic
1177388554 21:20437783-20437805 ATACATTTCTTTAGGCAGTGTGG - Intergenic
1177921689 21:27160621-27160643 AAGTATTTTTTAAGTTAATGTGG - Intergenic
1178936958 21:36871302-36871324 ATTTACTTCTTTAGGTATTGGGG - Intronic
1179760912 21:43527913-43527935 ATTTATTTAATAAGGTAATGGGG - Intergenic
1180459298 22:15545281-15545303 ATATATATGTTTAGGTTATGAGG + Intergenic
1182469670 22:30540541-30540563 TTGTATTTTTTGTGGTAATGAGG - Intronic
1185377844 22:50490285-50490307 ATGTATTATTTTAGCTATTGGGG - Intronic
949413761 3:3795238-3795260 ATGAATGTCTTTATGTAATCGGG - Intronic
949802799 3:7921808-7921830 ATGTATTTCTTTCTCCAATGAGG + Intergenic
952743721 3:36759003-36759025 ATATATTTGTTTTGGTTATGTGG + Intergenic
954551515 3:51485680-51485702 ATGTATTTCTTTTGGTTTTATGG - Intronic
956187635 3:66577589-66577611 AAGTATTTCTTTAGAAAAGGGGG + Intergenic
956237332 3:67088623-67088645 ATGGACTTCTTTGGGTAGTGTGG - Intergenic
956399115 3:68857863-68857885 TTGTATTTCTTCAGGTAATATGG - Intronic
956842246 3:73151618-73151640 ATTTATTTCTTTATGAGATGGGG + Intergenic
956861764 3:73331283-73331305 ATTTATTTCTATAGGTTTTGGGG + Intergenic
957182550 3:76899159-76899181 ATTTATTTTTCAAGGTAATGGGG + Intronic
957896051 3:86422017-86422039 ATGTCTTTCTTTAGGAAAGGTGG + Intergenic
958082427 3:88763495-88763517 ATAAATTTCTTTGGGTAATATGG + Intergenic
958136889 3:89505413-89505435 ATGTATATCTTTAGCCAATGGGG + Intergenic
958169469 3:89919803-89919825 ATCTTTTCCTTTAGGTAATGAGG - Intergenic
959093732 3:101931182-101931204 ATGTGATTCTTTAGGTCATCTGG - Intergenic
959122559 3:102249741-102249763 ATATATCTCATTAAGTAATGGGG + Intronic
959597922 3:108147866-108147888 TTGTATATCTTTATGTAAAGCGG + Intergenic
962678598 3:137775540-137775562 ATGTATTCCTTTAGTTAGTAAGG + Intergenic
962710086 3:138078847-138078869 ATGTTCTGCTTTAGGTAATGTGG + Intronic
963250034 3:143094939-143094961 ATGGAATTCTTTGTGTAATGTGG + Intergenic
963304369 3:143634754-143634776 ATGTATTTGTTTGGGGATTGTGG + Intronic
963564477 3:146911016-146911038 ATGAATTTCTTTAGTGGATGAGG + Intergenic
963701776 3:148635755-148635777 ATGTATTGCTTTGGGTGATATGG - Intergenic
963744339 3:149110711-149110733 ATCTTTTCCTTTAGGTCATGAGG - Intergenic
964519610 3:157550031-157550053 ATGTATTTTTATAGGTGAGGTGG + Intronic
964958246 3:162389408-162389430 ATGTAATTGTTTAGACAATGCGG + Intergenic
967444221 3:189546581-189546603 GCTTTTTTCTTTAGGTAATGAGG - Intergenic
967785220 3:193485885-193485907 ATTTATTTCTTTAGTTATGGAGG - Intronic
968243747 3:197119777-197119799 ATATAATTCTTTAAGTAATCTGG - Intronic
970266630 4:14295482-14295504 ATCTATTTCTTAAGATAGTGGGG - Intergenic
970915230 4:21324834-21324856 ATGGATTGCTTTAGGTAGTATGG + Intronic
971062967 4:22993169-22993191 ATATAGTACTTTAGGTGATGAGG + Intergenic
971241825 4:24896195-24896217 ATGTCTTTGTTTATATAATGAGG + Intronic
971598440 4:28562025-28562047 ATTTTTTTCTTTAGAGAATGTGG + Intergenic
972184480 4:36512514-36512536 ATACATTTTTTTATGTAATGAGG + Intergenic
973231067 4:47838903-47838925 ATGGCTTTCTTTAAATAATGGGG - Intergenic
974134017 4:57791965-57791987 ATTTATTTCTGTAAGTGATGAGG + Intergenic
974362134 4:60894839-60894861 ATTTCTTTTTATAGGTAATGAGG - Intergenic
974447191 4:62000392-62000414 ATGTATTTCTTTAGGTAATGTGG + Intronic
975149734 4:71007177-71007199 ATCAATTTCTTAAGATAATGAGG - Intronic
975198736 4:71559136-71559158 ATTTATTTCTCTAGGTGATGAGG + Intronic
976660599 4:87536446-87536468 ATATATTTATTTATTTAATGAGG + Intergenic
976805282 4:89039320-89039342 ATGTTTTTCTTTAATAAATGGGG - Intronic
977261987 4:94808271-94808293 GTTGTTTTCTTTAGGTAATGGGG - Intronic
978580073 4:110222789-110222811 AGTTAATTCTTTAGATAATGAGG + Intergenic
978663897 4:111159953-111159975 ATATATCACTTTAGGTAGTGTGG - Intergenic
979402821 4:120271210-120271232 TTGTACAACTTTAGGTAATGTGG + Intergenic
979813612 4:125070763-125070785 ATGTGTCTCTTGAGCTAATGTGG - Intergenic
979971423 4:127140489-127140511 GTTTATTTGTTTAGGTAGTGGGG - Intergenic
980466157 4:133185791-133185813 ATGTATTGCTTTAGTTTCTGCGG + Intronic
980788785 4:137590875-137590897 ATGAGTTTCTATATGTAATGTGG - Intergenic
980982272 4:139664898-139664920 TTGTATTTCTTTAAGAGATGGGG + Intergenic
981148279 4:141350874-141350896 ATGCATTTCTTTTTGTAATTTGG + Intergenic
983035425 4:162859258-162859280 ATCTATTTTTATATGTAATGTGG - Intergenic
984460274 4:180026939-180026961 ATGAATTTCTGTAGAGAATGAGG + Intergenic
985088371 4:186338535-186338557 ATTGATTGCTTTGGGTAATGTGG + Intergenic
985108727 4:186525329-186525351 ATTTATTTTTTTGGATAATGTGG - Intronic
985307166 4:188555842-188555864 ATGCATTTCTCTATGTAATTTGG - Intergenic
985478591 5:93272-93294 ATGTAAATCTTCATGTAATGTGG + Intergenic
986661146 5:10061307-10061329 TTGTATTACTTTAGGTATTTAGG - Intergenic
987275956 5:16362785-16362807 ATCTTTTCCTTTAGGTAATGAGG + Intergenic
987512851 5:18863166-18863188 ATGTATTTCTTTTAGAAAAGTGG + Intergenic
988046203 5:25957964-25957986 CTATCTTTCTTTAGGGAATGAGG + Intergenic
989074993 5:37555383-37555405 ATGAATTTCTTAAGGTTATGAGG + Intronic
989266076 5:39475513-39475535 ATTTATTTCTTTAGATAGTCTGG - Intergenic
989988233 5:50728557-50728579 GTGTAGTTCTTTAGGAACTGAGG - Intronic
990206188 5:53432109-53432131 ATGTATTTCTTAAGGGAAAATGG - Intergenic
990402197 5:55450139-55450161 ATGTGTCTCTCTATGTAATGTGG - Intronic
992129193 5:73674591-73674613 ATGTATTTTTTATGCTAATGAGG + Intronic
992129831 5:73681067-73681089 ATGCATTACTATAGGAAATGTGG - Intronic
993806853 5:92421100-92421122 ATCTTCTCCTTTAGGTAATGAGG - Intergenic
994478467 5:100301309-100301331 AAGTAACTTTTTAGGTAATGTGG + Intergenic
994663250 5:102678153-102678175 ATGTATTTTCTTAGAAAATGAGG + Intergenic
994916401 5:105985370-105985392 GTGTATTTCTTTATTTAATTAGG - Intergenic
995100830 5:108302781-108302803 AGGTTTTTCTTTAGAAAATGAGG - Intronic
995622738 5:114044936-114044958 AGGTACTTCATTAGGTACTGGGG + Intergenic
995907763 5:117146413-117146435 ATTTATTTCTTTATGGTATGAGG + Intergenic
996239476 5:121177986-121178008 ATTTTTTTCTTTTGGTTATGGGG + Intergenic
996324210 5:122253648-122253670 GTGGATTTCTTTAGGCAATATGG + Intergenic
996740079 5:126790655-126790677 AGGTAATTCTTTATTTAATGAGG - Intronic
997862952 5:137435614-137435636 ATGTATTTCTTTAAGTAAAGTGG + Intronic
998125108 5:139613644-139613666 ATGTTTTTCTTTCTTTAATGAGG + Intronic
998261916 5:140638256-140638278 TTTGATTTTTTTAGGTAATGTGG + Intergenic
998433861 5:142090064-142090086 ATGTCTTTCTTTATGTACTAGGG - Intergenic
999066851 5:148696612-148696634 ATGCACTTCTGTAGGTAACGGGG + Intergenic
999573738 5:152949932-152949954 AAGTATTTCATGAGATAATGTGG - Intergenic
999824840 5:155264104-155264126 AGTTCTTTCTTTAGGTAATCAGG + Intergenic
999862422 5:155662844-155662866 AAGTTTTTCTTGAGGTATTGAGG + Intergenic
1000402389 5:160844476-160844498 ATGTATTTCTTTTGGTGTGGTGG - Intronic
1000409849 5:160926823-160926845 ATAGATTTCTTTTGGTACTGTGG + Intergenic
1000639485 5:163684816-163684838 AAGACTTTCTTTAGATAATGTGG + Intergenic
1001222366 5:169912230-169912252 ATTTATTTATTTAGAAAATGGGG + Intronic
1001249446 5:170135487-170135509 ATTTTATTCTTTAGGTAATTGGG + Intergenic
1002097173 5:176838304-176838326 ATTTATTTCTATAGGCATTGGGG - Intronic
1002341882 5:178522232-178522254 ATGTTTTGCTTTATGTAATTTGG + Intronic
1003777458 6:9384918-9384940 ATGTCATTCTTTAGTTAATGGGG + Intergenic
1003850095 6:10213350-10213372 ATTTATTTCAATAGGTTATGGGG + Intergenic
1004074295 6:12330961-12330983 ACTTATTTCTTTGGGGAATGAGG + Intergenic
1004210360 6:13635070-13635092 ATGTATATTTTTAAGTAGTGAGG - Intronic
1004287631 6:14337327-14337349 ATGTATTTTTACAGGAAATGTGG + Intergenic
1004711325 6:18173387-18173409 TTGTAGTTCTTTATGTAATCTGG + Intronic
1006258774 6:32851841-32851863 AGGTTTTTCTTAAGGTAAGGAGG + Intronic
1006279761 6:33041404-33041426 ATTTATTTCTATAGGTTATTGGG + Intergenic
1007164095 6:39816270-39816292 ATGTATTTATTTTTGCAATGGGG + Intronic
1008006476 6:46415047-46415069 ATGTATGTCTTTGGTTACTGAGG + Intronic
1008158287 6:48044995-48045017 TTGTATTTCTATAAGAAATGGGG - Intronic
1008627423 6:53331317-53331339 ATTTATTTATTTTGGAAATGGGG - Intronic
1008800179 6:55358801-55358823 ATGTCTTTCATTAGGTGAGGGGG + Intronic
1010369973 6:75096302-75096324 ATATAGATCTTTAGGTAATGGGG - Intronic
1010832608 6:80549416-80549438 ATGTTTTTCTGTAGGCAAAGGGG - Intergenic
1010924912 6:81733069-81733091 ATCTAACTCTTAAGGTAATGAGG + Intronic
1010989561 6:82464975-82464997 GTCTTTTCCTTTAGGTAATGAGG + Intergenic
1012005852 6:93712182-93712204 ATATATTGCTTTAGGTAGTATGG + Intergenic
1012056936 6:94425107-94425129 ATTTATTTGTTTATGTAATGAGG - Intergenic
1012079763 6:94741302-94741324 ATGTATTGCTTTTGGCAATATGG - Intergenic
1012181055 6:96153191-96153213 ATGTATTTCTTTACCAAATTTGG - Intronic
1012724791 6:102796914-102796936 ATGTATTTCTGTAGGTTATTGGG - Intergenic
1013383920 6:109605261-109605283 ATTTATTTTTTTAGGATATGGGG - Intronic
1014092893 6:117425320-117425342 TTTTATTTCTTTAGGGTATGTGG - Intronic
1014510178 6:122310969-122310991 ATGTTTTTATTTAAATAATGTGG + Intergenic
1014697470 6:124641488-124641510 ATGTATTTCTTCTGATTATGTGG - Intronic
1016899514 6:149087724-149087746 ATGTACTTCTTTTGGGAAGGGGG + Intergenic
1017322065 6:153105850-153105872 ATTTCATTCTGTAGGTAATGGGG + Intronic
1017335016 6:153246548-153246570 ATGTTTTTCTTGTGGTAATTTGG + Intergenic
1018519708 6:164634249-164634271 ATGTATTTCTTTTACTAATGAGG + Intergenic
1021912323 7:25398576-25398598 ATGTATTTATTAAATTAATGTGG - Intergenic
1023063801 7:36354693-36354715 ATGTATTTCTTTGATTAAAGTGG + Intronic
1023141472 7:37106523-37106545 ATGTATTTCTTATGGTTCTGGGG - Intronic
1023758072 7:43438782-43438804 ATGTATTTCTTTAGGTAACAGGG + Intronic
1025232171 7:57210067-57210089 ATGTATATCTTGTGGTAATGGGG - Intergenic
1027385939 7:77659825-77659847 ATTTATTTTTTTAAGAAATGGGG + Intergenic
1027697291 7:81427692-81427714 TTGTATTTCTCTTTGTAATGTGG - Intergenic
1028258975 7:88637494-88637516 ATATATTTAGTTAGGTTATGTGG - Intergenic
1028837813 7:95394406-95394428 ATGACATTCTTTAGGTAATGTGG + Intronic
1028863408 7:95680225-95680247 ATATATATCTCCAGGTAATGTGG - Intergenic
1029309250 7:99646187-99646209 ATATATTGCTTTGGGTATTGTGG + Intergenic
1030560867 7:111084259-111084281 CTGTAATTCTCTAGGTAACGAGG + Intronic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1031359178 7:120826530-120826552 ATGTATGGGTTTTGGTAATGGGG - Intronic
1032480324 7:132240852-132240874 ATATATTTCTTAAGGGAATTTGG + Intronic
1033976735 7:147111941-147111963 ATGTATTGCTTTGGGCAATATGG + Intronic
1036523553 8:9514579-9514601 ATTTATCTCTCTAGGAAATGGGG - Intergenic
1036930258 8:12950024-12950046 TTGTATTTCTTTCAGAAATGAGG + Intronic
1037056437 8:14447606-14447628 ATGTATGTGTTTAGGTTATGGGG - Intronic
1037401752 8:18501107-18501129 ATCTTTTTCTTTGGGTATTGGGG - Intergenic
1038905254 8:31894982-31895004 ATACATTTATTTAGTTAATGTGG + Intronic
1041146139 8:54878016-54878038 ATGTACTTCTCTTGGTAATTGGG + Intergenic
1041840920 8:62269999-62270021 TTATCTTTCTTTAGCTAATGCGG + Intronic
1042172099 8:66001398-66001420 ATGTATTTATTTAGAGATTGGGG - Intergenic
1042370189 8:67982597-67982619 ATGTATTTCATTTGGGAATTTGG + Intronic
1042458823 8:69038396-69038418 AAGTATTTCTTTAGTTGATTGGG + Intergenic
1042488641 8:69374807-69374829 ATTTATTTATTTATGTAATTGGG - Intergenic
1042544590 8:69939947-69939969 ATGTATCTCTGTATGTACTGTGG + Intergenic
1043327114 8:79066044-79066066 ATGTATTTGTTTAGACAATAAGG + Intergenic
1046414152 8:113889479-113889501 AAGTGTTTCTTTATGTAATAAGG + Intergenic
1047427900 8:124763416-124763438 TTGAATTTTTTTAGGTAAGGTGG - Intergenic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1048361692 8:133702804-133702826 TTGTTTTTCTTTTGCTAATGAGG - Intergenic
1051543407 9:18247031-18247053 ATGTGTTTTTTTGGGTATTGGGG + Intergenic
1051713282 9:19955200-19955222 ATGTATCTTTATAAGTAATGGGG + Intergenic
1051793821 9:20840234-20840256 ATAGATTTCTTTAAATAATGTGG + Intronic
1051794983 9:20857163-20857185 ATAGATTGCTTTAAGTAATGTGG + Intronic
1053401082 9:37823378-37823400 TTGTACTTCTGTAGGTAATCTGG - Intronic
1055452807 9:76445975-76445997 ATTGATTTATTTAGGAAATGGGG - Intronic
1055620538 9:78120818-78120840 AAGCATTTCTTTAGAAAATGAGG - Intergenic
1056180113 9:84074416-84074438 ATGTATTTCTTTTGGGGCTGGGG + Intergenic
1056520454 9:87396409-87396431 ATCTCTTTCTTTAGCTAAAGAGG - Intergenic
1056831240 9:89919036-89919058 AAGTAATTCTGTAGTTAATGTGG + Intergenic
1057055600 9:91958231-91958253 CTGGGTTTCTTTAGGAAATGGGG + Intergenic
1058221197 9:102304808-102304830 ATGGATTGCTTTAGGTAGTATGG + Intergenic
1058316646 9:103575767-103575789 ATGTGTATCTTTCGGTAAAGTGG - Intergenic
1059786386 9:117590644-117590666 AAGTATTTCTAGAGGTAAAGAGG + Intergenic
1059829363 9:118076384-118076406 TTGTATTTCTTTAACCAATGTGG - Intergenic
1186105669 X:6203123-6203145 ATGTTATTCTGTAGGCAATGGGG - Intronic
1186491306 X:9975327-9975349 ATGTATTTCTTTTATTAGTGAGG + Intergenic
1187780605 X:22818517-22818539 ATTTAACTCTTTAGTTAATGAGG + Intergenic
1187789135 X:22929525-22929547 ATGTATTTATTTAGGGGATGGGG - Intergenic
1188930342 X:36101621-36101643 ATACATTTCTTTAGTTAAGGGGG + Intronic
1189243804 X:39546984-39547006 ATGAATTACTTTGGGTAATATGG - Intergenic
1189501650 X:41566262-41566284 AGGTATTTGATTAGGAAATGAGG + Intronic
1189925596 X:45951042-45951064 ATGAATTAGTTTAAGTAATGAGG - Intergenic
1190137962 X:47814725-47814747 ATGTATTTTGTTATGTATTGTGG - Intergenic
1190411594 X:50141706-50141728 ATGGATTTGCTTAGGTAAAGAGG - Intergenic
1191766273 X:64702035-64702057 TTGTATTTCTTTGGGTACAGTGG + Intergenic
1191781282 X:64869717-64869739 ATTTATTTATTTTGGTAGTGTGG + Intergenic
1192082284 X:68060029-68060051 ATGTATTTGTTTATTTAATCAGG - Intronic
1193004360 X:76599051-76599073 ATGTATTTAATTAGGAAAAGAGG - Intergenic
1194932477 X:99904333-99904355 ATTTATTTCTGTAGGTTATTAGG - Intergenic
1195377691 X:104243864-104243886 GGGTATTTCTTGAGGTACTGGGG + Intergenic
1196342927 X:114617129-114617151 ATGTTTTTCTTGAAGTAATTTGG - Intronic
1196530096 X:116776250-116776272 ATTTATTTCCATAGGTTATGGGG - Intergenic
1196552811 X:117049954-117049976 GTATATTGCTTTAGGTAGTGTGG - Intergenic
1196891750 X:120298046-120298068 AGTTATTTGTTCAGGTAATGGGG - Intronic
1197099208 X:122631848-122631870 ATAGATTTCTTTAGGTAGTATGG + Intergenic
1197310475 X:124899202-124899224 ATGTAGTACTTTAGGTAACAAGG - Intronic
1197627345 X:128816996-128817018 AGGTAAGTGTTTAGGTAATGAGG + Intergenic
1198635577 X:138695979-138696001 ATGTACTGCTTTAGTTAAGGTGG + Intronic
1198923413 X:141757273-141757295 ATTTATTTCTATAGATAAAGAGG - Intergenic
1199006236 X:142700118-142700140 ATAGATTGCTTTGGGTAATGTGG + Intergenic
1199018861 X:142851815-142851837 ATGTATTTCAATAGGTTTTGGGG - Intergenic
1199207325 X:145164228-145164250 ATGTATTTCTGTACCTGATGCGG + Intergenic
1199587203 X:149428012-149428034 ATACATTACTTTAGGTAATATGG - Intergenic
1200579303 Y:4929333-4929355 ATGTATTGCTTTGGGTACTATGG - Intergenic