ID: 974449556

View in Genome Browser
Species Human (GRCh38)
Location 4:62035434-62035456
Sequence ATTTCCTTCTAGATGAGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 362}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974449556_974449560 14 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449560 4:62035471-62035493 TGTACCTCAGGAAAATAATGCGG 0: 1
1: 0
2: 2
3: 28
4: 238
974449556_974449558 2 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449558 4:62035459-62035481 ACCATTTTGCTGTGTACCTCAGG 0: 1
1: 0
2: 1
3: 11
4: 188
974449556_974449564 26 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449564 4:62035483-62035505 AAATAATGCGGGATGTTGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 99
974449556_974449565 27 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449565 4:62035484-62035506 AATAATGCGGGATGTTGCAGGGG 0: 1
1: 0
2: 0
3: 4
4: 82
974449556_974449566 28 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449566 4:62035485-62035507 ATAATGCGGGATGTTGCAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 101
974449556_974449561 15 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449561 4:62035472-62035494 GTACCTCAGGAAAATAATGCGGG 0: 1
1: 0
2: 0
3: 14
4: 189
974449556_974449563 25 Left 974449556 4:62035434-62035456 CCCTTTCTCATCTAGAAGGAAAT 0: 1
1: 0
2: 2
3: 34
4: 362
Right 974449563 4:62035482-62035504 AAAATAATGCGGGATGTTGCAGG 0: 1
1: 0
2: 0
3: 5
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974449556 Original CRISPR ATTTCCTTCTAGATGAGAAA GGG (reversed) Intronic
900643192 1:3697031-3697053 ATTTCCTGCTGGCTGAGACACGG - Intronic
901834454 1:11915047-11915069 ATATCCTTCCAGCGGAGAAATGG - Intergenic
902106994 1:14046084-14046106 ATTTCCAACTAGATGATTAAAGG - Intergenic
904505578 1:30950286-30950308 ATTTCCTTCTACTTAAGTAATGG - Intronic
904516911 1:31063139-31063161 ATTTCCTTTTAGAACAGAATGGG - Intronic
904966180 1:34375763-34375785 TTTTTCTTTTAAATGAGAAAAGG - Intergenic
905592646 1:39177963-39177985 ATTTCAATCAAGTTGAGAAATGG + Intronic
906553671 1:46689333-46689355 ATGTCTTTCAAGATAAGAAAAGG + Intronic
906850284 1:49241357-49241379 ATTTCATCTTTGATGAGAAAAGG - Intronic
907245572 1:53106325-53106347 CTTTCCTACTAGATAAAAAACGG + Intronic
910062388 1:83109617-83109639 ATTTCCATCTAGACAAGTAAAGG - Intergenic
910368447 1:86490515-86490537 GTTTTCTTCTAAATGAGGAAAGG - Intronic
910589232 1:88911804-88911826 TTTTCTTTCTAAATGGGAAAGGG + Intergenic
911061631 1:93752792-93752814 AGTCCCTTCTCTATGAGAAATGG - Intronic
911274799 1:95848427-95848449 ATTTCCTTCATGTTGTGAAAGGG + Intergenic
912443651 1:109716997-109717019 CTGTTCTTCTATATGAGAAACGG + Intronic
913008904 1:114663436-114663458 TTTTCCATTTAAATGAGAAATGG + Intronic
913356647 1:117929669-117929691 ATTTCCTCCTAGAAGGCAAAGGG + Intergenic
913392563 1:118330772-118330794 ATTTGCTTTTGGATGAGAAATGG - Intergenic
914341003 1:146760512-146760534 ATATCATTTTACATGAGAAAGGG + Intergenic
914731839 1:150378546-150378568 ACTTGCTTCTATATGAGAATGGG - Intronic
915699479 1:157777408-157777430 ATTTCCTTATTCATGTGAAAGGG - Intergenic
917407871 1:174727911-174727933 ATTTCTTTGTAGAAGAGGAAAGG + Intronic
917976278 1:180240974-180240996 ATTTCTTACTTGATAAGAAATGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
923117279 1:230954106-230954128 ACTTCATTTTAAATGAGAAAAGG - Intronic
923281072 1:232443371-232443393 TTTTCCTTTTTGATGAGGAAAGG - Intronic
923356615 1:233162364-233162386 AATCCCTTCGATATGAGAAAGGG - Intronic
923999296 1:239533039-239533061 ATTTCCCTTTCGATGAGAAAAGG + Intronic
924718144 1:246597820-246597842 CCTTCCTTACAGATGAGAAAAGG - Intronic
924747027 1:246845601-246845623 ATTTCCTTATATATTTGAAATGG - Intronic
1063887762 10:10596709-10596731 CTTTCCTTCTTTCTGAGAAATGG - Intergenic
1063901686 10:10739646-10739668 ATTGCTTTCTGGAAGAGAAAAGG - Intergenic
1064719286 10:18212545-18212567 ATTTCTTACAAGATGAGAAATGG - Intronic
1064871094 10:19937776-19937798 ATTTCTTTCTAGATGAGGAAGGG + Intronic
1065403467 10:25333681-25333703 ATATCCTTCAAAATGAGAAGAGG + Intronic
1065441619 10:25758157-25758179 ATTTCCTTCTAGTTCACAACAGG - Intergenic
1067961660 10:50859702-50859724 ATTTCCTTCTCTTTTAGAAAGGG + Intronic
1068065357 10:52123665-52123687 ATTTACTTCAATATGTGAAAAGG + Intronic
1068482634 10:57612706-57612728 AATTCCTTCAGGATCAGAAAGGG - Intergenic
1068558351 10:58483282-58483304 ACTTCCTTCAATATGAGAAGTGG - Intergenic
1069001200 10:63268028-63268050 ATTTCCTGTTAAATGTGAAATGG - Intronic
1069095961 10:64259890-64259912 ATTTCCTCCTAGAGGACACAGGG + Intergenic
1069758761 10:70792934-70792956 ATTCCATTCTAGAAGAAAAAGGG - Intergenic
1070731890 10:78834884-78834906 ACTTCCTTCTGGAAGACAAAAGG + Intergenic
1071221814 10:83476074-83476096 TAATCCTTCTAGCTGAGAAACGG + Intergenic
1072523154 10:96247678-96247700 ACTGCGTTATAGATGAGAAATGG + Intronic
1073211483 10:101806518-101806540 ATTTTCATCTAAATGATAAAAGG + Intronic
1073215298 10:101832871-101832893 CATTCCTTTTAGATGGGAAAGGG - Intronic
1075258380 10:120943343-120943365 ATTCCCTCCTAGACGAGAATTGG + Intergenic
1076296004 10:129385298-129385320 ATTTCATTCTGCAAGAGAAAGGG + Intergenic
1076316274 10:129544219-129544241 ATGTAATTCTAGATGAGAACTGG - Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078320182 11:10327418-10327440 TTTTCCTGCTAGATAAGAATGGG + Intronic
1078954999 11:16183405-16183427 TATTCCTTCTAGATGCTAAAGGG - Intronic
1080238537 11:30099717-30099739 ATTTCCTTCTAGAAGTAACATGG + Intergenic
1080540944 11:33264453-33264475 TTTTCCAACTAGATTAGAAATGG - Intronic
1081261133 11:40962293-40962315 CTTTCCTTCTAAATGATGAAGGG - Intronic
1081264089 11:40997741-40997763 AGAGCCTTCTAGATGAGAACAGG + Intronic
1081298968 11:41427056-41427078 TTATCTTTCTAGTTGAGAAATGG + Intronic
1082065603 11:47897081-47897103 TTTTCCTTCTAAGTGAGAAAAGG - Intergenic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1082980601 11:59117044-59117066 TTTTCCCTCTAAGTGAGAAAGGG - Intronic
1085770647 11:79322629-79322651 ATTTGGTAGTAGATGAGAAAGGG + Intronic
1085871293 11:80352806-80352828 GTTTCCTTCTAGATAAAAGAGGG + Intergenic
1086020316 11:82220461-82220483 ATTTGCTTCTAGTGGAGAAATGG - Intergenic
1086055185 11:82638400-82638422 ATTTCTTTCTGGATGATACAGGG + Intergenic
1086747309 11:90445707-90445729 ATTTCCTTCTACATAAAATACGG + Intergenic
1087082818 11:94187949-94187971 ATTTCCTTGTGTCTGAGAAAAGG - Intergenic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1090256630 11:125288961-125288983 ATTACCTTCTTCTTGAGAAAGGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1093277091 12:17142606-17142628 TGTTCCTTCAAGATCAGAAAAGG - Intergenic
1093669184 12:21852419-21852441 AATTCCTGCAAGATGACAAAAGG - Exonic
1093885720 12:24457943-24457965 ATTTCCTTATAGAATAAAAATGG - Intergenic
1093937275 12:25014678-25014700 ATTTGATTCTCCATGAGAAAGGG + Intergenic
1095251533 12:39984737-39984759 ATGTCCGTCTTGATGAAAAATGG + Intronic
1095372662 12:41487942-41487964 ATTTCTTTCTAGATTTAAAAAGG - Intronic
1096442929 12:51661184-51661206 ATTTGATTTTAGATGAGGAAAGG - Intronic
1096536187 12:52276528-52276550 TTATCCTTGTAGAAGAGAAAAGG + Intronic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1098677087 12:73303356-73303378 ATTTCCTCCTAGAAGGAAAATGG + Intergenic
1099654022 12:85466699-85466721 ATTTCCTTTTAGAAGACACAAGG - Intergenic
1100413358 12:94345702-94345724 ATTTCCTCCTGGATAAGGAAGGG - Intronic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101456604 12:104838200-104838222 ATGTTCTACTGGATGAGAAATGG + Intronic
1104283074 12:127396251-127396273 ATTTCATTCTAGTAGAGGAATGG - Intergenic
1104481737 12:129113747-129113769 ATCTCCTTCTCGGTGGGAAAGGG + Intronic
1105397404 13:20051798-20051820 ATTTCATGCTAATTGAGAAAAGG + Intronic
1105987655 13:25584482-25584504 TTCTCCTTCTAGATGAAAAAAGG + Intronic
1106277498 13:28226518-28226540 AATTTGTACTAGATGAGAAATGG - Intronic
1106382526 13:29253979-29254001 AATTCCTTCAAGATGAGATTTGG + Intronic
1106628659 13:31446691-31446713 AATTCCTTCCTGATCAGAAAGGG + Intergenic
1106636667 13:31535927-31535949 GTTACCTTCTACATGAAAAAGGG + Intergenic
1106721159 13:32435741-32435763 ATGTCTTTCTAGTTGAGAAATGG + Intronic
1107246407 13:38301534-38301556 ATTTCCCTGTAGAGAAGAAAGGG - Intergenic
1108412075 13:50159696-50159718 AATTGCTTCTTGAAGAGAAAAGG + Intronic
1109860162 13:68187779-68187801 ATGTCATTCTAGAGGAGAGAAGG + Intergenic
1109860424 13:68190834-68190856 ATTTACTCATAGATCAGAAATGG - Intergenic
1110343795 13:74423042-74423064 ATTTACTGCTAGATGGAAAATGG + Intergenic
1110660216 13:78051930-78051952 ACTTACCTTTAGATGAGAAAAGG - Intergenic
1110697054 13:78503303-78503325 ATTTTTTTCTAGATGTTAAAGGG - Intergenic
1111160725 13:84391557-84391579 ATTTGCTTCTGAATGAGAATTGG - Intergenic
1114628227 14:24143184-24143206 ATTGACTACTGGATGAGAAAGGG + Intergenic
1116089699 14:40289589-40289611 TTTTTTTTCTAAATGAGAAAAGG + Intergenic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117090876 14:52248721-52248743 ATTTTCATATAAATGAGAAAGGG - Intergenic
1117673727 14:58134276-58134298 ATTTGCTTTCAGATCAGAAAAGG + Intronic
1117908980 14:60618484-60618506 ATATCCTTCTAGGTCTGAAAAGG + Intergenic
1118240622 14:64054167-64054189 AGTGCCTTCTAGTTTAGAAAAGG + Intronic
1119235104 14:73013102-73013124 ATTTCCTTCTACTTGAGACTAGG - Intronic
1120139676 14:80915056-80915078 ACTTACTTATTGATGAGAAAGGG + Intronic
1120362117 14:83517684-83517706 TTTTCTTTCTAGAATAGAAATGG - Intergenic
1120911176 14:89668293-89668315 ATTTCCTTAAAGATTAAAAAGGG - Intergenic
1121864975 14:97354412-97354434 ATATCCTTATAGAGGAGGAAGGG - Intergenic
1122042016 14:98994921-98994943 ATTTCGTTCTAGAAGAAAACAGG + Intergenic
1124187053 15:27540038-27540060 ATTTCGTTATAGTTCAGAAAAGG - Exonic
1124876579 15:33600648-33600670 TTCTCCTTCTAGATGGGAGAAGG + Intronic
1125133146 15:36308254-36308276 ATTTTCTTCTAGATTAGCTATGG + Intergenic
1126378803 15:48024642-48024664 CTTTTCTTCTAAATGGGAAAGGG + Intergenic
1126396292 15:48221573-48221595 ATTTTTTTCTAAATGAAAAATGG + Intronic
1126913950 15:53444483-53444505 GTTTCCTTTGAGATGAGATATGG - Intergenic
1126945216 15:53811874-53811896 ATTTCCTTATATATGTGAGACGG + Intergenic
1127447339 15:59077996-59078018 AGTTCATTCTGGATGAAAAAAGG - Intronic
1129036904 15:72655515-72655537 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129212983 15:74081710-74081732 ATTTCCAGCTAGAAGGGAAATGG - Intronic
1129397419 15:75259376-75259398 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129401028 15:75283653-75283675 ATTTCCAGCTAGAAGGGAAATGG + Intronic
1129415125 15:75372282-75372304 ATTTTCTTCTAAAGGAGCAAAGG + Intronic
1129730120 15:77926026-77926048 ATTTCCAGCTAGAAGGGAAATGG - Intergenic
1130789051 15:87132646-87132668 ACTTCCTTGTAGATGGGATATGG + Intergenic
1130907155 15:88248949-88248971 ATTTCCTTATCTATAAGAAATGG - Intronic
1131115127 15:89790757-89790779 TTTTCCTTCCAAATGGGAAAAGG + Intronic
1131199241 15:90382752-90382774 TTTTACTTCTAGAGGAAAAAAGG - Intergenic
1132161360 15:99545992-99546014 TTTGCCTTGGAGATGAGAAAAGG - Intergenic
1134031273 16:10994409-10994431 ACCTCCTTCTGGATGAGAACAGG + Intronic
1135351557 16:21733657-21733679 TATTCGTTCTAGATGAGAAATGG + Intronic
1135450040 16:22549784-22549806 TATTCGTTCTAGATGAGAAATGG + Intergenic
1135583979 16:23653227-23653249 ATTTCCTTCTAGAGTAGCCAAGG + Intronic
1135804643 16:25531775-25531797 AATTCCTGCTAGATCAGCAATGG - Intergenic
1138026435 16:53525820-53525842 ATTTTCTTCAAGCAGAGAAAAGG - Intergenic
1138946140 16:61852462-61852484 ATTTGCTTCTAGATCATACAAGG - Intronic
1138957992 16:61994423-61994445 ATTTCCTTAGACATGAGGAATGG + Intronic
1138963564 16:62056351-62056373 ATGTCCTTCTAGGTCTGAAATGG - Intergenic
1139993283 16:70956894-70956916 ATATCATTTTACATGAGAAAGGG - Intronic
1140187162 16:72785233-72785255 TTTTCTTTTTACATGAGAAAGGG + Exonic
1141837440 16:86551618-86551640 ATTTGCTTCTGGATGACAGACGG - Intronic
1144036330 17:11369335-11369357 ATTTTCCTCTAGATGTTAAAAGG + Intronic
1146451286 17:32976104-32976126 GTTTCCTTACATATGAGAAAAGG - Intronic
1148288679 17:46420657-46420679 AATTCCTGCTAGATAGGAAAAGG + Intergenic
1148310848 17:46638235-46638257 AATTCCTGCTAGATAGGAAAAGG + Intronic
1149973487 17:61242545-61242567 ATGTCCTTCTAAATGGGAGAAGG - Intronic
1150119346 17:62586907-62586929 ATTTCCTTCTAGAAGAGACTGGG + Intronic
1151026375 17:70682226-70682248 ATTTTCTTCCATATCAGAAATGG - Intergenic
1152056814 17:78035065-78035087 CTCTCATTTTAGATGAGAAATGG - Intronic
1152106607 17:78333097-78333119 ACTTACTTCTAGATGAGCACTGG + Intergenic
1152992122 18:373122-373144 ATTTCCATCTTGATGAAAAATGG + Intronic
1153297413 18:3560653-3560675 ATTTTTTTCTAAATGGGAAAAGG + Intronic
1155586212 18:27368889-27368911 AATAGCTTCTAGAAGAGAAAAGG + Intergenic
1156685543 18:39641055-39641077 TTTTCTTTCTAGGTTAGAAATGG + Intergenic
1156854106 18:41762238-41762260 ATATCCTTTTATATGGGAAAAGG - Intergenic
1156966720 18:43103274-43103296 ATTTCCTCAAAGATGAAAAAGGG + Intronic
1158220892 18:55149709-55149731 TTTTCCTACTAGATGGGACAAGG - Intergenic
1159411620 18:68083983-68084005 ATTTCCTACCAGATTGGAAATGG + Intergenic
1159678719 18:71320104-71320126 ATTTCTTTCAAGATGGGACATGG + Intergenic
1162614536 19:11786882-11786904 ATTTTCTTCTATTTGAGACAGGG - Intergenic
1162653794 19:12113175-12113197 ATTTCTTTCTAAATCATAAAAGG + Intronic
1166657250 19:44621343-44621365 ATTCCCATTTTGATGAGAAAAGG - Intronic
924976170 2:177724-177746 ATTTCCTTCTAGTTGAATAAAGG + Intergenic
925753771 2:7113372-7113394 ATATAATTCTAGATCAGAAATGG + Intergenic
926620397 2:15041861-15041883 ATTTCCATGTAGTAGAGAAAAGG - Intergenic
927499738 2:23574827-23574849 ATTTCCTTGATGAAGAGAAATGG + Intronic
928318601 2:30265624-30265646 ATTTCCTTCTAGCATAGAAGTGG - Intronic
928422860 2:31153129-31153151 ATTTGCTTCTTGGTGAGGAATGG - Intronic
928601511 2:32908493-32908515 ATGTCCATCTAGATGGGAAGGGG - Intergenic
929823293 2:45290492-45290514 ATGACCTGCTAGATGAGAGAGGG + Intergenic
930242455 2:48950361-48950383 GTTTCCTTATAGTTGAAAAACGG - Intergenic
931582963 2:63796938-63796960 CTTTCCTTCTGCTTGAGAAAGGG + Intronic
932408557 2:71530590-71530612 ACCTCCTTCTAGAGGAAAAATGG - Intronic
933385559 2:81606462-81606484 ATACCCTTTTAGATGAGAAGTGG - Intergenic
933630277 2:84648145-84648167 TTTTTGTTCTAAATGAGAAAAGG + Intronic
933666492 2:84969503-84969525 ATCTCTTTCTACAAGAGAAATGG + Intergenic
933759172 2:85662381-85662403 GTTTCCTTCTAGAACTGAAATGG - Intronic
934994622 2:98945987-98946009 TTTTCCTTCTAGAGGTGCAAGGG - Intergenic
935432872 2:102995566-102995588 ATTACCTTCTAAAACAGAAAGGG - Intergenic
935497562 2:103800367-103800389 TTTTCCTTCTGCATGATAAAGGG + Intergenic
935948270 2:108305574-108305596 ATTTCCTCCTTCATGAGAAAAGG + Exonic
936272802 2:111063805-111063827 ATATCCTTTTAGATAATAAAGGG + Intronic
938872659 2:135496901-135496923 ATTTCTTTCTTGATAAGCAAGGG - Intronic
939221915 2:139313037-139313059 AATTGCTTCTATATTAGAAAGGG - Intergenic
939733729 2:145817645-145817667 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
939859630 2:147402777-147402799 TTTTCCTTCTTGATGAAAAAGGG + Intergenic
939882202 2:147643216-147643238 ATATCCTTCTAGAAGAGGAGGGG - Intergenic
940459965 2:153952495-153952517 ATTTGGTTTGAGATGAGAAATGG + Intronic
940789148 2:158013460-158013482 ATTTAATTCTAGATGTGGAAAGG + Intronic
941081654 2:161068326-161068348 ATTTCCTTCTAGAGAAGAAAGGG - Intergenic
941263929 2:163335305-163335327 GTTTCACTCTAGATGAGAAGAGG + Intergenic
942554009 2:177152421-177152443 ATCTACTTCTACAGGAGAAAAGG + Intergenic
942593773 2:177572934-177572956 GTTTCCTTCAAGGAGAGAAAAGG - Intergenic
942704849 2:178759338-178759360 ATTTCCTTCTTGAAGATGAAAGG - Intronic
942772758 2:179542260-179542282 ATTTCCTGCAAGATGATAGAGGG + Intronic
943022742 2:182595063-182595085 TTTTTCTTCTAGAAAAGAAATGG + Intergenic
943534012 2:189124096-189124118 TTTACCTTAGAGATGAGAAAAGG + Intronic
943833930 2:192495106-192495128 ATTTCCATCTAGAAGGGGAAAGG - Intergenic
944437005 2:199700909-199700931 TTTTTTTTCTAGTTGAGAAAGGG - Intergenic
944763878 2:202844659-202844681 ATTTCTTTCTAGAGGAGGAGTGG - Intronic
944888730 2:204093915-204093937 TTTTCCTTTGAGATTAGAAAGGG - Intergenic
944943532 2:204656015-204656037 ATTTCCTTTGCTATGAGAAAAGG - Intronic
945886778 2:215384177-215384199 ATTTCCTCCTGTATGAAAAAGGG + Exonic
946614062 2:221490439-221490461 AATTCATTCTGGATGGGAAATGG + Intronic
947906467 2:233766838-233766860 ACTTCCTTCTAAAGGAGGAAGGG - Intronic
948029839 2:234808397-234808419 ATTTCCTTTTTTTTGAGAAAGGG + Intergenic
948292154 2:236833609-236833631 AATTCCTTTTAGATGAGAATGGG - Intergenic
948406693 2:237726798-237726820 ATTTCCTTATAGATGAATTAAGG + Intronic
948882389 2:240866568-240866590 ATTCCCTTCTAGAAGGAAAAGGG + Intergenic
1169620446 20:7500701-7500723 AGTTAGTTCTAGATGAGAACAGG - Intergenic
1170388858 20:15850562-15850584 ATCTCCTTCTATGTGAGAAATGG - Intronic
1171429848 20:25076061-25076083 ATTTCATTCTAGAATGGAAACGG - Exonic
1173957515 20:47045659-47045681 ATATCCGTCTACATGAGCAATGG + Intronic
1174138082 20:48394178-48394200 ATTTCCTTGTTGCTGAGGAACGG + Intergenic
1174883109 20:54302582-54302604 AGCTCCTCCTAGATGAGCAAGGG - Intergenic
1174938538 20:54898456-54898478 ATCTCCTTCTGCTTGAGAAAAGG + Intergenic
1175055913 20:56198012-56198034 GTTTCCTTCTAGTTGAGTGAGGG + Intergenic
1175409451 20:58756587-58756609 ATTTCCCTTCAGAAGAGAAAAGG + Intergenic
1175537773 20:59727045-59727067 ATTTCCTTGTAGGTGATGAAAGG - Intronic
1175740555 20:61417148-61417170 ATTTCCTTCTTCTTCAGAAAAGG + Intronic
1177335090 21:19713636-19713658 TTTGCCTTCTTCATGAGAAATGG - Intergenic
1182369749 22:29802376-29802398 ATTTCCTTCTCTGTGAAAAAGGG + Intronic
1183643423 22:39107351-39107373 ATGTCCTTCTAGAAGAGTAAAGG - Intergenic
1184997584 22:48220578-48220600 AATTCATTCTAGAATAGAAATGG + Intergenic
949154017 3:807640-807662 TTTTTTTTCTAAATGAGAAATGG + Intergenic
949776502 3:7638564-7638586 TTTTCTTTCTAAATGAAAAATGG + Intronic
949962609 3:9325620-9325642 ATGTCCTTCTAGACGAGTGAAGG + Intronic
950132946 3:10560071-10560093 ATTGCCTGCTAGATTTGAAAGGG - Intronic
950347614 3:12311899-12311921 ACTTCATTCTAGATGACACATGG - Intronic
950709799 3:14806018-14806040 ATTTTCTTCTAGGTGACAAAAGG + Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951820744 3:26808379-26808401 ATTTCTATCTAAATGAGACAGGG - Intergenic
952697996 3:36292561-36292583 GTTTCCTGCTAGATCACAAATGG + Intergenic
953139731 3:40216472-40216494 ATTTCCGTTTATAGGAGAAACGG - Intronic
953437336 3:42888670-42888692 ATTTTTTTCTAAACGAGAAATGG - Intronic
953597835 3:44335047-44335069 ATCCCATTCTAGATGAAAAAGGG - Intergenic
953760799 3:45685386-45685408 AGTTCCTTCTACATGACAATGGG + Exonic
955036538 3:55273596-55273618 CTTTCCTTTTAGATGGGAAAGGG - Intergenic
955998036 3:64698066-64698088 ATTTCCTTCTAGATCAGTTTTGG - Intergenic
958667214 3:97156775-97156797 ATTTTCTTCTATTTGAGGAAGGG + Intronic
960052178 3:113249541-113249563 AGCTTCTTTTAGATGAGAAATGG + Intronic
960462789 3:117957459-117957481 ATTTACTTCTTGATAAGTAAAGG + Intergenic
960793668 3:121460814-121460836 ATTTACCTATAGATTAGAAATGG + Intronic
961673043 3:128548785-128548807 ATTTCTTACTCGATGAGAAATGG - Intergenic
962960284 3:140304858-140304880 ATTTCCTACTTGAGGAGAAGAGG - Intronic
963455832 3:145546066-145546088 ATTTTCTTTTAGATTTGAAATGG - Intergenic
964205394 3:154169076-154169098 ATTACTTTATAGATGAGGAAAGG + Intronic
964296913 3:155243375-155243397 ATTTACTTCAAGATGACTAAGGG + Intergenic
964383458 3:156121720-156121742 AATTCCTTTGAGATGAAAAATGG + Intronic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
967447659 3:189585404-189585426 ATTTCACTCTAGATCAGAGAGGG - Intergenic
968456323 4:702258-702280 CTGTCCTGCGAGATGAGAAAAGG - Intergenic
970921823 4:21403531-21403553 ATTTTATTCTAGATGAAAAGTGG - Intronic
972229694 4:37057122-37057144 ATTTCCTTCCAGTTAATAAAAGG + Intergenic
972667702 4:41183127-41183149 ATTTCCTTATAAATTAGATATGG - Intronic
972684735 4:41341271-41341293 ATTCACTTCTGGATGAGAAAAGG - Intergenic
973814298 4:54604564-54604586 AGTCCCTTTTAGCTGAGAAAGGG - Intergenic
974290577 4:59924650-59924672 TTTTTTTTCTAAATGAGAAAAGG - Intergenic
974449556 4:62035434-62035456 ATTTCCTTCTAGATGAGAAAGGG - Intronic
975052887 4:69887994-69888016 ATTTGCTTATATATTAGAAATGG - Intergenic
975295262 4:72726952-72726974 GTTTCCTTCTGCTTGAGAAAAGG + Intergenic
975521355 4:75304651-75304673 ATTGCTATGTAGATGAGAAAAGG - Intergenic
977982513 4:103341320-103341342 CTTTCCTTCTAGCTAAAAAATGG - Intergenic
978108031 4:104928579-104928601 TTTTTCTTCTAGATGTGAAATGG + Intergenic
978815893 4:112905152-112905174 GATTCCTTCTAGAAAAGAAACGG - Intronic
979871403 4:125827378-125827400 ATTTCATGCTAGTTGTGAAATGG + Intergenic
980171361 4:129294049-129294071 AGTACCTTCTTAATGAGAAATGG - Intergenic
980597876 4:134978705-134978727 ATTTATTTCTAGATCAGAAAAGG - Intergenic
980754401 4:137138527-137138549 ATTTCCTCATAGATGAAATAAGG + Intergenic
980992411 4:139749117-139749139 ATTTTCTTCAAATTGAGAAAAGG + Intronic
981944712 4:150327644-150327666 ATCTCTTTGTAGATGGGAAACGG - Intronic
982404510 4:155004966-155004988 TTTTCCTATTATATGAGAAAAGG + Intergenic
982412107 4:155090065-155090087 ATTTCCTCCAAGATGAGATGAGG + Intergenic
982648790 4:158059605-158059627 ATTTGCTTCTCTATGAGACAAGG - Intergenic
982975934 4:162060354-162060376 ATTTCCTTCGAGTTGTGAAATGG + Intronic
984582503 4:181526163-181526185 ATTTCCTTCAACCAGAGAAATGG - Intergenic
986151685 5:5135761-5135783 ATTTGTTTCCACATGAGAAAGGG + Intergenic
987083717 5:14449207-14449229 ATTTCCTTCCAGAGGTGAGATGG - Intronic
988234724 5:28527464-28527486 GTTTCCAAATAGATGAGAAAAGG - Intergenic
988676979 5:33442245-33442267 ATTTAATTCTAGATGATAAATGG + Intronic
988863703 5:35311299-35311321 ATTTCCTAGTGGTTGAGAAAGGG + Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
989481697 5:41938257-41938279 AGTTTCTTCTATATGTGAAATGG + Intronic
989781651 5:45272776-45272798 ATTTTCTTCCTGATGAGTAAAGG - Intronic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
993222041 5:85111410-85111432 ATTTCCTTGTTGTTGGGAAAAGG + Intergenic
994660982 5:102654053-102654075 CTTTGCTTCTAGGTAAGAAAGGG - Intergenic
994844560 5:104970595-104970617 ATTTTCTTCTAAATGATGAAAGG + Intergenic
994885414 5:105555039-105555061 ATTGCCTTCTAGATGTGTATGGG + Intergenic
995415807 5:111911606-111911628 ATTCACAACTAGATGAGAAAAGG + Intronic
996739664 5:126787334-126787356 ATTTGCTTCTAAATGGAAAATGG + Intronic
998437642 5:142126566-142126588 AAATCCTTATATATGAGAAAAGG - Intronic
999761440 5:154704158-154704180 CTTTTTTTCTAAATGAGAAATGG + Intergenic
999781715 5:154855777-154855799 ATTTTCTTTTAGTAGAGAAAGGG - Intronic
1000845738 5:166277926-166277948 ATTTCATGTGAGATGAGAAATGG - Intergenic
1001604924 5:172952756-172952778 ATTCACTTCTAGAGGAGAGAAGG + Intergenic
1002024239 5:176385895-176385917 CTCTCTTTCTAGATGAGAAATGG - Intronic
1003048431 6:2757841-2757863 ATTTCCTTCTTAATGTAAAAAGG + Intergenic
1004005992 6:11637562-11637584 CTTTCCTTGTACTTGAGAAAAGG - Intergenic
1005145107 6:22680583-22680605 ATTAAGTTCAAGATGAGAAATGG - Intergenic
1005671137 6:28107433-28107455 CATTCCTTCTATTTGAGAAAAGG + Intergenic
1006550119 6:34815571-34815593 ATTTTCTTTTAGCTGACAAAAGG + Intronic
1007626955 6:43252063-43252085 TTGTCCTTCTAGAGAAGAAAAGG + Intronic
1007835556 6:44671390-44671412 AGTTCCTTGTTGCTGAGAAATGG - Intergenic
1008455333 6:51704366-51704388 ATTTTCTTCTATAAGATAAAGGG + Intronic
1009781725 6:68280078-68280100 CTTTCCTTCCACTTGAGAAATGG + Intergenic
1009875914 6:69505220-69505242 AATTCCTTCTTGGTTAGAAAAGG - Intergenic
1010888697 6:81276890-81276912 TTTACATCCTAGATGAGAAAAGG + Intergenic
1012968010 6:105696241-105696263 ATTTCCTGTCATATGAGAAAAGG + Intergenic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1016676303 6:146773099-146773121 ATTTCCTTCCACATCAGAAATGG + Intronic
1017574934 6:155791689-155791711 ATTTCTTCCTAGATAAGGAATGG - Intergenic
1017630898 6:156395612-156395634 TTTGCCTTCTATAGGAGAAAGGG + Intergenic
1018019387 6:159745100-159745122 ATTTCCCTTTACACGAGAAATGG + Intronic
1018215175 6:161519295-161519317 ATTTTCGACTAGATGAGGAAGGG - Intronic
1018584250 6:165338120-165338142 TTTTCCCTCTTGATTAGAAATGG - Intronic
1021704123 7:23350123-23350145 TTTTGGTTCTACATGAGAAATGG + Intronic
1021711842 7:23423713-23423735 ATTTCCTTATAGCTTATAAAGGG + Intronic
1021900720 7:25282450-25282472 ATTTCCTTATAGATAAGAGTAGG - Intergenic
1022848596 7:34236450-34236472 ATGAACTTCCAGATGAGAAAAGG - Intergenic
1023109199 7:36793030-36793052 ATTTCCTTATAAGTGAGAGATGG + Intergenic
1023374854 7:39545842-39545864 AATTCATTCTAGATGATGAAAGG + Intergenic
1023688260 7:42759686-42759708 TTTTTCTTCTAAATGGGAAAAGG + Intergenic
1024439510 7:49399721-49399743 TTTACCTTCTAGAAGAGACAAGG - Intergenic
1026547936 7:71340239-71340261 ATATTCTGCCAGATGAGAAAGGG - Intronic
1027534163 7:79375214-79375236 ATTTCATTCTGTATGAAAAAAGG + Intronic
1027780597 7:82515328-82515350 GTTTCCTTCTAAAGGATAAAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1030170176 7:106593339-106593361 ATTTCCTACTTGCTAAGAAATGG + Intergenic
1030684450 7:112470202-112470224 GTCTCCTTCTAAAGGAGAAATGG + Intronic
1031010430 7:116521020-116521042 ATTTCCTTCCACATATGAAATGG + Intergenic
1031403823 7:121358874-121358896 ATTTCTTTTTACATTAGAAATGG + Intronic
1031896188 7:127350802-127350824 TTTTCCTGCTTGATGAGGAAAGG - Intronic
1032241225 7:130160845-130160867 TTTTCCTTCAAGTTTAGAAATGG + Intergenic
1033832674 7:145272418-145272440 ATTTCATTCTACATTTGAAATGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1034226084 7:149483696-149483718 ATTTCCTTCTACTTTTGAAAAGG - Intronic
1035976417 8:4316767-4316789 ATTTACTTCTGGATTTGAAAAGG - Intronic
1036528886 8:9562822-9562844 TTTTCTTTCTAGATGGGCAAAGG + Intronic
1037929381 8:22868722-22868744 ATTTCCTGCTAGATTCGATATGG - Intronic
1038982850 8:32778264-32778286 ATTTCATTCAAGAGGACAAAGGG - Intergenic
1039102984 8:33960263-33960285 TTTTTTTTCTAAATGAGAAACGG + Intergenic
1040592658 8:48808809-48808831 TTTTCTATCTAGTTGAGAAAGGG - Intergenic
1041712665 8:60908454-60908476 ATTTAATTCTAGATTAAAAAAGG + Intergenic
1042085758 8:65106957-65106979 ATCTCCTGTTAGATGATAAAGGG - Intergenic
1043184171 8:77124701-77124723 CTTTCTTCCTAGATGAGAAATGG - Intergenic
1043602285 8:81955090-81955112 ATTTCCTTCTATCAGAAAAAGGG + Intergenic
1044840673 8:96334127-96334149 CCTTCCTTCTAGAGCAGAAAAGG + Exonic
1045660100 8:104428416-104428438 ATTCATTTCTAGATGAGAAATGG - Intronic
1046142420 8:110111361-110111383 ATTACCTTCAAGAAGAGAAAGGG - Intergenic
1046340995 8:112854047-112854069 TTTTCTTTCTGGATGAAAAAAGG + Intronic
1046357289 8:113104536-113104558 ATTTTCTTCTCCATGAGAAAGGG - Intronic
1046699162 8:117380692-117380714 CTTTCCTCCAGGATGAGAAAGGG - Intergenic
1046710822 8:117509568-117509590 TTTTTCTTCTTGATGACAAATGG - Intergenic
1048481746 8:134802452-134802474 AGTTCCTTCTACATGAGTCATGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1050749064 9:8915739-8915761 ATTTCCTCTTAGTTGAGAAAGGG + Intronic
1050761520 9:9077786-9077808 ATTTCCTTGGAAATGTGAAAGGG + Intronic
1051500333 9:17769767-17769789 ATTACGTTCTATATGAGAAATGG - Intronic
1051512816 9:17898165-17898187 ATTTCCTTTTAGAAAAAAAATGG - Intergenic
1052943879 9:34151740-34151762 CTTCCCTTCTTGATGAGAGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056264990 9:84888284-84888306 AATTTCTTATAGATGAGGAAAGG + Intronic
1056303205 9:85263257-85263279 ATTTCCTCATAGGTGAGACAGGG + Intergenic
1056788423 9:89609749-89609771 ATTTTATTCTAGTTGATAAAGGG - Intergenic
1058729215 9:107833992-107834014 TTTTCCTTCTCCATGAGAAGTGG + Intergenic
1059437631 9:114286029-114286051 AATGCCTTCTAAGTGAGAAAAGG - Intronic
1059788339 9:117611666-117611688 ATATTCTACTATATGAGAAAAGG - Intergenic
1060617178 9:125027819-125027841 ATTGCCTTTTAGATTACAAATGG + Intronic
1062090185 9:134672180-134672202 ATTTCCTGCTAGATGCCAATTGG + Intronic
1186130973 X:6464980-6465002 GTATCTTTCTAGATGACAAATGG + Intergenic
1187560147 X:20394946-20394968 CTTGCCTTCTATACGAGAAAAGG - Intergenic
1187581234 X:20609649-20609671 GTTTTCTTCTAAATGAAAAATGG + Intergenic
1187856240 X:23638155-23638177 TTCTCCATCTAGAGGAGAAAAGG + Intergenic
1188048551 X:25456302-25456324 ATTTCCTGTTGGATGGGAAAAGG + Intergenic
1188381026 X:29492740-29492762 ATTTCCTTGTACATGGCAAAGGG - Intronic
1188809352 X:34633777-34633799 ATTTCCCTCTAGTGGAAAAATGG + Intronic
1189731751 X:44028377-44028399 ATTACCTTCAAGCTAAGAAAAGG - Intergenic
1189904974 X:45748989-45749011 CTTTACATTTAGATGAGAAAAGG + Intergenic
1190017482 X:46839910-46839932 ATTTCCTTGCAGCTTAGAAAAGG + Intronic
1190036525 X:47030345-47030367 ATCTCTTTCTATGTGAGAAAGGG - Intronic
1192148751 X:68698892-68698914 ATTGCCTGGTAGATAAGAAAAGG - Intronic
1192748234 X:73961413-73961435 AATTTCTTCTTGATCAGAAAAGG - Intergenic
1193217916 X:78886380-78886402 ATTATTTTCTAGATTAGAAAGGG - Intergenic
1194311323 X:92311058-92311080 AATTTCTATTAGATGAGAAACGG + Intronic
1195152605 X:102087486-102087508 ATGTGATTCTAGATGAAAAAAGG + Intergenic
1195310669 X:103629273-103629295 ATTTCTTTTCAGATGAGAAGTGG - Intronic
1197670582 X:129273036-129273058 AACTCCTTCTACTTGAGAAAAGG - Intergenic
1197717688 X:129721163-129721185 AATTCCTTGCAGATCAGAAAAGG + Intergenic
1197883399 X:131192711-131192733 ATTTACTTATAGATTTGAAAAGG + Intergenic
1198054722 X:132982426-132982448 ATTACCTGATGGATGAGAAATGG + Intergenic
1200619601 Y:5425347-5425369 AATTTCTATTAGATGAGAAACGG + Intronic
1201613428 Y:15868661-15868683 ATATCTTTCTAGATGACAAATGG + Intergenic