ID: 974451106

View in Genome Browser
Species Human (GRCh38)
Location 4:62061300-62061322
Sequence GTAGATTCACATGCTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974451105_974451106 6 Left 974451105 4:62061271-62061293 CCTAGATTACTTTTCGTTTTGAG 0: 1
1: 0
2: 0
3: 14
4: 267
Right 974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG No data
974451103_974451106 11 Left 974451103 4:62061266-62061288 CCCTGCCTAGATTACTTTTCGTT 0: 1
1: 0
2: 0
3: 26
4: 444
Right 974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG No data
974451104_974451106 10 Left 974451104 4:62061267-62061289 CCTGCCTAGATTACTTTTCGTTT 0: 1
1: 0
2: 3
3: 26
4: 329
Right 974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG No data
974451102_974451106 19 Left 974451102 4:62061258-62061280 CCACTGTGCCCTGCCTAGATTAC 0: 1
1: 3
2: 53
3: 450
4: 3171
Right 974451106 4:62061300-62061322 GTAGATTCACATGCTGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974451106 Original CRISPR GTAGATTCACATGCTGTTGT AGG Intronic
No off target data available for this crispr