ID: 974458333

View in Genome Browser
Species Human (GRCh38)
Location 4:62156962-62156984
Sequence CCTTCTTTCCTGGATTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974458328_974458333 -10 Left 974458328 4:62156949-62156971 CCATACTGACTCACCTTCTTTCC No data
Right 974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG No data
974458327_974458333 -2 Left 974458327 4:62156941-62156963 CCTTAATTCCATACTGACTCACC No data
Right 974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG No data
974458326_974458333 14 Left 974458326 4:62156925-62156947 CCTGATATCTTTATCTCCTTAAT No data
Right 974458333 4:62156962-62156984 CCTTCTTTCCTGGATTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974458333 Original CRISPR CCTTCTTTCCTGGATTGGGA AGG Intergenic
No off target data available for this crispr