ID: 974460536

View in Genome Browser
Species Human (GRCh38)
Location 4:62181699-62181721
Sequence GCATTTAATCTGCTGAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974460531_974460536 24 Left 974460531 4:62181652-62181674 CCTTTGTCTTTAGATCCCAAGCT No data
Right 974460536 4:62181699-62181721 GCATTTAATCTGCTGAATCTAGG No data
974460533_974460536 8 Left 974460533 4:62181668-62181690 CCAAGCTCAACATTCAGCATCCT No data
Right 974460536 4:62181699-62181721 GCATTTAATCTGCTGAATCTAGG No data
974460532_974460536 9 Left 974460532 4:62181667-62181689 CCCAAGCTCAACATTCAGCATCC No data
Right 974460536 4:62181699-62181721 GCATTTAATCTGCTGAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974460536 Original CRISPR GCATTTAATCTGCTGAATCT AGG Intergenic
No off target data available for this crispr