ID: 974466059

View in Genome Browser
Species Human (GRCh38)
Location 4:62258087-62258109
Sequence CTGGAGACACAGAGAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974466059_974466062 -1 Left 974466059 4:62258087-62258109 CCATTTTCTCTCTGTGTCTCCAG No data
Right 974466062 4:62258109-62258131 GGCCATCTTTCCTTTGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974466059 Original CRISPR CTGGAGACACAGAGAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr