ID: 974467277

View in Genome Browser
Species Human (GRCh38)
Location 4:62273405-62273427
Sequence ATGGAGAACCTGAATCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974467277_974467281 5 Left 974467277 4:62273405-62273427 CCTTCCAGATTCAGGTTCTCCAT No data
Right 974467281 4:62273433-62273455 CTTCTCAGCCTATGACTCCAGGG No data
974467277_974467280 4 Left 974467277 4:62273405-62273427 CCTTCCAGATTCAGGTTCTCCAT No data
Right 974467280 4:62273432-62273454 ACTTCTCAGCCTATGACTCCAGG No data
974467277_974467282 6 Left 974467277 4:62273405-62273427 CCTTCCAGATTCAGGTTCTCCAT No data
Right 974467282 4:62273434-62273456 TTCTCAGCCTATGACTCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974467277 Original CRISPR ATGGAGAACCTGAATCTGGA AGG (reversed) Intergenic
No off target data available for this crispr