ID: 974472767

View in Genome Browser
Species Human (GRCh38)
Location 4:62339402-62339424
Sequence CATGTTCAGCAGACAGTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974472767_974472775 23 Left 974472767 4:62339402-62339424 CCCCTCACTGTCTGCTGAACATG No data
Right 974472775 4:62339448-62339470 AGTGGCATAAATTCTTTTCTGGG No data
974472767_974472774 22 Left 974472767 4:62339402-62339424 CCCCTCACTGTCTGCTGAACATG No data
Right 974472774 4:62339447-62339469 AAGTGGCATAAATTCTTTTCTGG No data
974472767_974472772 5 Left 974472767 4:62339402-62339424 CCCCTCACTGTCTGCTGAACATG No data
Right 974472772 4:62339430-62339452 GTTATGGCCAAATTCTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974472767 Original CRISPR CATGTTCAGCAGACAGTGAG GGG (reversed) Intergenic
No off target data available for this crispr