ID: 974476518

View in Genome Browser
Species Human (GRCh38)
Location 4:62388668-62388690
Sequence CCGGCCAACATGATGTTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974476505_974476518 30 Left 974476505 4:62388615-62388637 CCGCCCGCCTGGGCTTCCCAAAG 0: 29
1: 2646
2: 68366
3: 179116
4: 183336
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data
974476506_974476518 27 Left 974476506 4:62388618-62388640 CCCGCCTGGGCTTCCCAAAGTGC 0: 106
1: 7933
2: 159416
3: 254528
4: 206598
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data
974476507_974476518 26 Left 974476507 4:62388619-62388641 CCGCCTGGGCTTCCCAAAGTGCT 0: 108
1: 8296
2: 157932
3: 180711
4: 109349
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data
974476512_974476518 14 Left 974476512 4:62388631-62388653 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data
974476509_974476518 23 Left 974476509 4:62388622-62388644 CCTGGGCTTCCCAAAGTGCTGGG 0: 167
1: 11623
2: 215255
3: 263948
4: 174298
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data
974476513_974476518 13 Left 974476513 4:62388632-62388654 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 974476518 4:62388668-62388690 CCGGCCAACATGATGTTTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974476518 Original CRISPR CCGGCCAACATGATGTTTAG AGG Intergenic
No off target data available for this crispr