ID: 974481180

View in Genome Browser
Species Human (GRCh38)
Location 4:62445700-62445722
Sequence TACTCTGGGAAGAATCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481180_974481185 21 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data
974481180_974481187 30 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data
974481180_974481186 29 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481186 4:62445752-62445774 AAGTTCCTTTGTGGGAGTTTTGG No data
974481180_974481184 20 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481180 Original CRISPR TACTCTGGGAAGAATCAACC AGG (reversed) Intergenic