ID: 974481181

View in Genome Browser
Species Human (GRCh38)
Location 4:62445714-62445736
Sequence TGTGAAATAATTGTTACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481181_974481184 6 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data
974481181_974481185 7 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data
974481181_974481186 15 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481186 4:62445752-62445774 AAGTTCCTTTGTGGGAGTTTTGG No data
974481181_974481189 23 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481189 4:62445760-62445782 TTGTGGGAGTTTTGGGATTCAGG No data
974481181_974481191 30 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481191 4:62445767-62445789 AGTTTTGGGATTCAGGAAGGAGG No data
974481181_974481187 16 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data
974481181_974481190 27 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481190 4:62445764-62445786 GGGAGTTTTGGGATTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481181 Original CRISPR TGTGAAATAATTGTTACTCT GGG (reversed) Intergenic
No off target data available for this crispr