ID: 974481182

View in Genome Browser
Species Human (GRCh38)
Location 4:62445715-62445737
Sequence TTGTGAAATAATTGTTACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481182_974481186 14 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481186 4:62445752-62445774 AAGTTCCTTTGTGGGAGTTTTGG No data
974481182_974481191 29 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481191 4:62445767-62445789 AGTTTTGGGATTCAGGAAGGAGG No data
974481182_974481184 5 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data
974481182_974481185 6 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data
974481182_974481187 15 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data
974481182_974481190 26 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481190 4:62445764-62445786 GGGAGTTTTGGGATTCAGGAAGG No data
974481182_974481189 22 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481189 4:62445760-62445782 TTGTGGGAGTTTTGGGATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481182 Original CRISPR TTGTGAAATAATTGTTACTC TGG (reversed) Intergenic