ID: 974481184

View in Genome Browser
Species Human (GRCh38)
Location 4:62445743-62445765
Sequence CATAGACAAAAGTTCCTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481180_974481184 20 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data
974481182_974481184 5 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data
974481181_974481184 6 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481184 4:62445743-62445765 CATAGACAAAAGTTCCTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481184 Original CRISPR CATAGACAAAAGTTCCTTTG TGG Intergenic
No off target data available for this crispr