ID: 974481185

View in Genome Browser
Species Human (GRCh38)
Location 4:62445744-62445766
Sequence ATAGACAAAAGTTCCTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481181_974481185 7 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data
974481180_974481185 21 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data
974481182_974481185 6 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481185 4:62445744-62445766 ATAGACAAAAGTTCCTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481185 Original CRISPR ATAGACAAAAGTTCCTTTGT GGG Intergenic
No off target data available for this crispr