ID: 974481187

View in Genome Browser
Species Human (GRCh38)
Location 4:62445753-62445775
Sequence AGTTCCTTTGTGGGAGTTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481181_974481187 16 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data
974481180_974481187 30 Left 974481180 4:62445700-62445722 CCTGGTTGATTCTTCCCAGAGTA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data
974481182_974481187 15 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481187 4:62445753-62445775 AGTTCCTTTGTGGGAGTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481187 Original CRISPR AGTTCCTTTGTGGGAGTTTT GGG Intergenic