ID: 974481190

View in Genome Browser
Species Human (GRCh38)
Location 4:62445764-62445786
Sequence GGGAGTTTTGGGATTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974481181_974481190 27 Left 974481181 4:62445714-62445736 CCCAGAGTAACAATTATTTCACA No data
Right 974481190 4:62445764-62445786 GGGAGTTTTGGGATTCAGGAAGG No data
974481183_974481190 -1 Left 974481183 4:62445742-62445764 CCATAGACAAAAGTTCCTTTGTG No data
Right 974481190 4:62445764-62445786 GGGAGTTTTGGGATTCAGGAAGG No data
974481182_974481190 26 Left 974481182 4:62445715-62445737 CCAGAGTAACAATTATTTCACAA No data
Right 974481190 4:62445764-62445786 GGGAGTTTTGGGATTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974481190 Original CRISPR GGGAGTTTTGGGATTCAGGA AGG Intergenic
No off target data available for this crispr