ID: 974484096

View in Genome Browser
Species Human (GRCh38)
Location 4:62484632-62484654
Sequence CTTTGAACCCAGCTGGATCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974484096_974484103 30 Left 974484096 4:62484632-62484654 CCGTGATCCAGCTGGGTTCAAAG No data
Right 974484103 4:62484685-62484707 GAGCTGCAAGATTCTGGAAATGG No data
974484096_974484102 24 Left 974484096 4:62484632-62484654 CCGTGATCCAGCTGGGTTCAAAG No data
Right 974484102 4:62484679-62484701 GATGTGGAGCTGCAAGATTCTGG No data
974484096_974484100 8 Left 974484096 4:62484632-62484654 CCGTGATCCAGCTGGGTTCAAAG No data
Right 974484100 4:62484663-62484685 ATAGACTCTTCCTCTAGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974484096 Original CRISPR CTTTGAACCCAGCTGGATCA CGG (reversed) Intergenic
No off target data available for this crispr